Archive for March, 2010

h1

5.5 Podcast 12 – Let’s meet under the Big Tent

March 28, 2010

Podcast Feed


Short podcast this week. Mainly for a large announcement.  No science or math this week, but something you might appreciate if you like the idea of community.

News under the Big Tent

The quilting podcasters are assembling under the Big Tent and we would like you to join us!

Thanks to Allison Rosen from Within a Quarter Inch for the idea of gathering all of us together in one place.  We can chat through the fourms, we can share photos and files, and announce events, and we can have our separate subgroups for each podcast.

The name of our Big Tent group is Quiltcast Supergroup.

Big Tent is just an online place to organize groups together. 

We can talk about podcast ideas, tips, projects, ask questions of each other, Big Tent helps to store the information in one place.

The group web address that you can sign up for our new Big Tent group is:

https://www.bigtent.com/groups/quiltsuper

On the right should be a sign up / login widget for you to join up. 

If you’re unsure about what Big Tent is, check out this video from the BigTent group.  It may explain a few things if you’re just getting started.

http://www.youtube.com/watch?v=dlps17RlVHI&feature=related

If you have any questions about Big Tent, I’ll do my best to find out the answers for you.

We’ve got many different subgroups already set up and a few more may be coming soon!

Other Cool Things to Share

Ruthann saw this Spoonflower fabric and thought of me. It’s retro and all sciency.

Glass Menagerie

Follow the link and click on several other science fabrics. Yum!

Although I think my favorite is this one:

And here is some DNA fabric for the back of your new DNA Quilt:

DNA Stripes

Don’t Forget

Sign up for the Quiltcast Supergroup on Big Tent here

Check out the following links:

Vicki pointed out an artist Betty Busby who does amazing nature inspired quilts.  I saw enormous amounts of detailed quilting in sea life, and the amount of leaves on some of the trees - spectacular! Nothing generic about the flowers or fish here, it all looks incredibly authentic!

Bananabanana showed me a perfectly spherical chrocheted sphere from Craftster.  The maker MsPremiseConclusion used math and polar coordinates (sine of theta) to come up with the perfect number of stitches in each row.  She says in the post that the traditional way is easier though.

Check out new fonts at dafont.  I would excersise some caution in downloading fonts and do not take responsibility if you download a font that crashes your computer.  Not that it will happen, but, ya never know.

Intro music cut into the Big Tent section of the podcast by IMperfect title Circus Town found at Mevio’s Music Alley.

Thanks to my commenters

Peggi, Rachel, Lynn, Bananabanana, Debby, Carol, Jill, Robyn, Vicki, Lauretta, Timelady, Deb, to the other podcasters for putting up with my tons of e-mails and questions this past few weeks (see sidebar for all the links) and Annie Smith for mentioning me very favorably in her latest podcast!

h1

5.4 Post Vernal Equinox Fever

March 25, 2010

It’s been on my mind the last few days to do a podcast about stereotypes, both quilting stereotypes and science stereotypes. 

But I am someone who surely doesn’t want to step on any toes here, and I am slightly worried that I may be misunderstood, and I could unintentionally offend someone. 

I am talking about the cultural stereotypes of crafters and the cultural stereotypes of scientists and/or nerds and/or geeks.

It could be an opinion-based podcast more than a factual one, and perhaps no one wants to hear one person’s opinions on fighting stereotypes. 

I can be as factual as possible, and potentially through extensive research I can find a way to touch on the subject more factually than I anticipate.

Or is it too “off topic” for me?

Any thoughts?  Is it silly to be scared about this? 

It is seriously the only idea that has given me a lot of ‘spark’ lately for a podcast topic.  And once I started thinking about it, I see stereotype (quilting and geek) examples everywhere.

As far as other things

Due to the Vernal Equinox we had a few days ago, I can’t concentrate all that much on the computer lately.  Or anything for that matter.

Image courtesy of Wikipedia

I do have to confess, the last week my mind has been on the great weather that is either here or just around the corner.  

After I got my posts done last week, I haven’t done anything crafty and just don’t sit that long at the computer either. 

I am sorry if I haven’t directly replied to all of your comments.  They really DO mean a LOT to me as a podcaster and crafter. 

It’s like I’m drawing blank about this quilting and blogging passion and I know it will pass, and I just want to straighten up all my quilty stuff and get to work on getting things put away.

And go fishing for an afternoon.

So that I can get my lure stuck in the tree like this:

And hopefully catch something like this:

h1

5.3 Slow quilting on National Quilting Day

March 21, 2010

I know I am a slow quilter.  I had a majority of the top of the fans done at the end of my day on Thursday.

When I took all day to do this and three out of four of them are not sewn down to the background, it makes me really notice how much I get distracted by bad tv shows and good movies playing in the background.

And here is the original photo that I took with poor lighting.

I just uploaded into flicker, edited photo with picnik, hit auto exposure button on Edit tab, then saved the picture.  Makes a world of difference!

Here is an upclose picture of the fan with the bias bar detail.  Only made 28 bias bars, each with Steam a Seam fusible web, that I used for the first time.  It is also my first machine applique project.

Only 3 more fans to sew down and all the bias to sew down.

And for something else:

An image I created with Flame

See you next week or so.

h1

5.2 Welcome to the family

March 19, 2010

I would like to welcome my new ruler and cutting mat to the family. Now I own two rulers.  Whoo hoo …

Less folding for me - yeah!

Oh and a thread rack too.   

Not the most exciting, but I don’t purchase things that often and have been using the really small ruler and cutting mat for over a year so it’s time to update to bigger and better supplies!  Maybe next year I can buy a triangle ruler! ;)

I also went on a goose chase and went to the local organic grocery store and didn’t see any quilts hanging up there.  I am sure I just missed them behind the bulk frankincense. 

Image courtesy of Wikipedia

Here is the molecular structure of a chemical that is the main ingredient in frankincense.

 

 Image also courtesy of Wikipedia

***** distracted again *****

With my sewing purchases I made tomorrow my next uninterrupted sewing day instead of today.  Didn’t find stabilizer though (distracted). 

Shoulda went to the quilt shop today, but tomorrow is a sale so I am holding off purchasing stabilizer and a thimble until tomorrow. 

That means early tomorrow morning I’ll have to start cutting the fan bottoms and bias strips in preparation for machine applique.  Oh I can make some mock up fans as well (good idea I should have thought of that). 

I should also start working through an irish/american flag quilt for a family member for christmas.  Getting the colors right together could be a little challenging.

Looks like one last blast of winter tomorrow, which will be okay with me if I’m inside all snuggly sewing.  Take care everyone!

h1

5.1 Day 1 of (un)interrupted sewing time

March 18, 2010

I have planned to sew as much as possible in the next few days as I have some mostly uninterrupted sewing time. 

This means my ipod music blaring as loud as I can stand.  First it was reliving some early episodes of Crafty Pod while I was straightening up to sew.

Then a phone call – of about an hour and a half – and then derailed myself on various computer things that “needed my attention“ I spent time reading blogs and other e-maily things. 

Then an hour of searching for 80′s songs to rock out to on iTunes

Then finally got to start sewing my fans together.

The edges are sewn, and yes, they are offset.  I plan to sew a fan bottom tomorrow and cover up the mismatched bottoms. 

I do have a dilemma though.  I have never worked with raw edge or machine applique. 

This seems to scream for machine applique.  I have a book for teaching me about machine applique, and it gives some suggestions for threadpainting over the applique for texture and color contrast.

I don’t want to lose the height on the red areas, but I don’t really want any of the raw edges to unravel. 

I wonder if I should have exaggerated the tops more and turned them under.  I also have never worked with a stabilizer before and this also seems to scream for that too. 

Suddenly a top that I didn’t have a ton of feeling for screwing up back a year ago (yes the top these fans are going onto is a year old this month) I am trying to make some decisions about. 

Too bad about doing that “low risk project” that you don’t have an invested interest in to get over your fears.  It seems I very much want this quilt to work and perhaps I lost the low risk feeling when I decided to take on the fans in the project.  “Y seams” again.  I really don’t mind them.  Honestly.

Tomorrow is day 2 of uninterrupted sewing time (after a full day of work).  I hope I can get more done tomorrow than today.

Oh and look at my new apron as a bday gift.  Since I never actually finished mine, this is good – and it gives me an idea of the binding strips.

Too bad it doesn’t make me feel more productive necessarily.  Will test out the apron / productivity theory more tomorrow. 

I am not sure if it is a direct relationship.  I know for sure it’s not an inverse relationship, which is also good.

One last thing, did I share my pi day pizza with you?

Yes we had this on Sunday.  Yum, it was good!

h1

5.0 It is lonely here

March 17, 2010

Hey all

If you are one of the people who can’t seem to scroll down to the bottom of my posts, I mentioned something about a computer aided drafting group I created on flickr.

If you’ve ever drafted a quilting pattern on the computer, and don’t mind sharing it with the world, you can check out my flickr group here.

Thats the Scientific Quilters Quilting Design Group or http://www.flickr.com/groups/sciquiltdesign/

I’d love for someone else to become a member at least.  Let me know I’m not talking just to myself.

You can also enter a giveaway by making a comment on the pi podcast blog, sending me e-mail, giving me show ideas, pretty much anything that proves you actually come to visit (at least for a little while).

Or maybe your ears aren’t ready to forgive me with all those ‘p’ sounds on the last podcast. 

In my headphones at the computer – it didn’t sound all that bad – in the car stereo – yikes! 

If I could find a way to drive my car into my house to listen through my car stereo maybe I would do so (and it would save me from having to go outside down the steps every morning to go start the car before work).

Anyway, come say hi.  I am going to be a quilting fool between now and sunday sometime.  I get to be loud and quilt whenever I want (after work).  Very nice for a change.

Also working hard to start raising some big tent poles.  And these poles are very large, but the circus to come I think could be amazing!  (you’ll be able to understand that reference soon) And no I’m not quilting a circus tent – am I that ridiculous? – wait don’t answer that!

h1

4.9 Podcast 11 – Lets Picnik with Pi

March 14, 2010

Podcast Feed


I am shortening this original idea from two websites to just one this podcast.  After I took all the screen shots from one website, I knew I had enough material to cover in one podcast by itself.  So we’ll do a picnik with pi instead of a picnik with pixlr pi.

With Pi Day right around the corner, I thought it would be a good time for a Pi Quilt.  One of my newer listeners e-mailed me with a great idea for a pi quilt.

  

What is Pi?

Pi is just a number.  Usually denoted with the greek letter for our english P. (written in english as pi)

 

Image courtesy Wikipedia

Pi is the wonderfully important mathematical relationship between a circumference of a circle compared to the diameter of that circle.  A mathematical ratio.

 

Image courtesy Wikipedia

Take the circumference (perimeter, measure along the outside) and divide by the diameter (width across the largest part of the circle) and you get this wonderfully irrational, transcendental number. 

Which approximates to 3.14159 ….

We can’t exactly find pi because the number doesn’t stop.  There have been geek contests to see who can recite by memory the most digits to pi, which the record is somewhere in the tens of fifty thousands at this point. 

There is a nice relationship between a circle’s area and pi.  The area of a circle is the value of Pi times the radius squared.

 

Image courtesy Wikipedia

Which may be useful if you’re wanting to calculate  the exact area of drunkard’s path blocks used in a quilt. 

But because fabric isn’t purchased in circular amounts, it may be best to know the diameter of each circle you need and find out how many circles you can get from this value instead of relying on the area of the circle.

  

What is Pi Day?

Pi Day was invented by the San Francisco Exploratorium to help promote the mathematical concept of Pi and mathematics in general.

Pi Day is celebrated on March 14, (03/14 in the United States) and it also happens to be Einstein’sbirthday!

We love to make pies on pi day. (Okay I usually don’t make them, but other people do.)

Look at this pi pie plate.  Image by Wikipedia

Or look at this pi pie.  Image by Wikipedia

  

Could we make a Pi quilt to take on a Picnik?

Using an idea by listener Lynn through e-mail, I recreated a pi quilt design using the online computer program Pixlr.

My original idea was to do a Pixlr and Flickr tutorial when talking about pi, but then i discovered Picnik through Flickr and by the time I got screenshots of Picnik I had more than enough for one podcast!

So instead you get a Pi quilt created in Pixlr and a tutorial on Picnik.  Picnik with Pi. 

Here is my Pi quilt idea.

As you can see this quilt has different (monotone) lengths of bars representing the different numbers of pi. 

I would love to embroider (or quilt) in between the information about Pi and Pi day so that people know what they are looking at. 

This uses length to impart information instead of color like my DNA quilt idea.

Which is what Lynn suggested for pi day because she saw somewhere an artist was doing this. 

For the color I went with monotone, alternating a dark and light color for each digit.  You could assign different colors to the different numbers if you wanted to.

I did have to break up some larger numbers when I hit the edge of my quilt.  This design would be using fairly large strips of fabric, but you could always reduce the square sizes.

 

Okay we have pi, now lets take a picnik!

I started looking at the image editing functions using Flickr.  I decided to make a tutorial about a few of the features of Picnik by way of Flickr

If you have a Flickr account, you can log in and follow along and see how to modify your pictures.

If you’ve never used flickr before one way to upload photos after you’ve signed in is to go to the You tab and click on upload photos.

You find the image on your computer.  Then you decide if you are making private or public photos and click on the button to upload.  Don’t forget to add a description if you want.

To get to Picnik through Flickr, you click on the edit photo button at the top.

Then you are taken to the picnik main page.  I noticed right away you can zoom in and out using the bottom right hand side.

On the top there are tabs of edit and create.  Looking at the edit tab first, we can examine some of the color and basic options here.

If the picture is not straight you can rotate. You can also flip.  I would think the flip could be useful if you had your own patterns which you needed the reverse for applique or transferring to fabric for embroidery or quilt markings.

NO stealing and posting other people’s patterns up on flickr.  No fair.  Do your own.  Delete or set to private for only you.  Read other artist’s comments about what you can do with their patterns before you try this.

The exposure button would be useful to get the right contrast.  If you click on the advanced tab you get a histogram on the right that shows you how much of each color value (light or dark) is in the photo and you can play around with these sliders as you would do with levels in a photo editing software like Photoshop.

Moving to the create tab you see a menu of different items to the left that you can play around with.  The green bars on the menu items on the left are expandable and show many effects. 

Anything that you don’t have access to due to premium status will say premium.  But there is plenty to do for free!

Just below the create tab are smaller tabs.  Clicking on the effects tab, one of the first things is black and white photos.  Now I discussed black and white photos using Photoshop in this post/podcast.

What I really like is you can do the splash of color by clicking on the little brush symbol on the bottom and brush away the black and white.

Another thing you can do is draw on your picture.  I used the doodle effect and then chose the difference mode. 

This should (in theory) give me the exact opposite of what I have.  So a dark blue becomes a light yellow, which makes sense if you look at a color wheel. 

I drew on the corner of my image and created instant contrasting colors and can see how they look together. 

One thing about doodle is if you don’t use a mode it is just solid color, which looks slightly odd next to fabric. But if you want solid color, that’s the way to go!

Scrolling down effects, then clicking on the sandbox gives me more options.  Like hexagons!  I could do my own grandmother’s flower garden quilt without the flowers!

And since I am a sucker for effects this is the ripple effect which I created equally sized waves along my picture, which gives a block effect.  I don’t know what this is useful for, but it is soo cool!

Moving to the next mini tab is the Text effects.  You type in your text in the left side, choose your color of text on the right side, and scroll down on the left to choose your font.  One sad thing about Pi is they don’t have the greek symbol font here.  :(

The next mini tab is stickers.  I chose a geometric square that had yellow color without choosing difference or hard light or anything like that.  You can see the solid color is distracting.

No half square triangles here though.  But they do have equilateral triangles so we can create flying geese units. 

In the last mini tab is frames, which could be very useful to figure out borders.  It doesn’t look like you can do multicolored or pieced borders, but for basic color you can get two borders with different thicknesses. 

This could be useful for uploading a completed quilt and could give a good idea of where to go with borders (basic colors and sizes).

Before leaving picnik if you like your changes to your photo you should save (top right of the web page).  When you do, it doesn’t overwrite your original image, and you only have that option if you have the premium version.

Later I discovered that you can go to Picnik’s site directly and upload photos from flickr, Facebook, Photobucket – all sorts of photo hosting sites.  You can also download to all those places as well.

 

What about a giveaway?

I mentioned something about a giveaway in my preview post.  Since I was already on flickr I set up a flickr group that is open to the public.

I have been thinking about my strength and rather than go science/math with this group, I thought I’d make a flickr group with the focus on computer aided design of quilts. 

The giveaway has to do with the Scientific Quilter Computer Design group on flickr. 

What is the prize?

A charm pack of Moda fabric.

I won it recently at a mini quilting retreat.  As you may be able to tell this isn’t the fabric I gravitate towards.  Although I need to expand my tastes, I know this will never get used if it stays in my house.

Here are a few more pictures (edited for color & exposure with picnik):

How do you win?

I am going to draw up a spreadsheet on google docs to help me organize this.  I am going to try a point system to give people multiple ways to win.  Hopefully this will not make my brain completely explode!

Each point is one name in the drawing.  How do you earn points?

Either

  • Sign up for the scientific quilter flickr group (http://www.flickr.com/groups/sciquiltdesign/) - 1 point
  • Comment on this post – 1 point
  • Send me an e-mail with the word Moda in the subject line (to scientificquilter (at) gmail (dot) com) – 1 point
  • Tell someone about quilting podcasts in general – 1 point

 

  • Comment on this post and mention something about pi (or math) not already discussed in the post or podcast – 3 points
  • Send an e-mail with a new show idea (this has to be a new e-mail starting from today) – 3 points
  • Blog about this post and put a direct link to your specific post in the comment section of THIS post – 3 points
  • Blog about pi day and put a direct link to your specific post in the comment section of THIS post – 3 points

 

  • Bake a pie for pi day and post the picture up in the flickr group – 5 points
  • Sign up for the group and post a picture in the group of a quilt that you designed by a computer program. (this could be using Illustrator, Photoshop, Paint, Pixlr, Flickr/Picnik, ArtoPic, Electric Quilt … others) - 5 points
  • Send any of the pictures mentioned above to me by e-mail – 5 points

 

  • Start your own NEW podcast and tell me about it (this has to be posted to iTunes by the deadline or close to the deadline) – 10 points

 

When is the deadline?

This is going out later than I wanted, so I’ll extend the deadline to Saturday April 10th  at midnight (US) central time.

Someone to highlight

Allyson at Guilding the Silly has an awesome periodic table knitted shawl that she created. 

She also made an awesome hat that has EKG patterns on it.

But I also particularly like the Möbius scarf of hers.

Thanks for waiting so long Allyson!

 

Something fun

  • For Pi Day, maybe you want to take the Pi Day Challenge?  I haven’t explored this, but feel free to try it out!

 

One More Thought (or two or three)

Oh yeah, I am planning on taking a fractal class from Quilt University.  Classes start on April 16.  It will be my first online quilt class, but I am excited about the topic – and hope to report my progress in the form of podcasting.  Send me an e-mail if you plan to join me!

Rachel is doing her own genome quilt on her site.  Check it out!

Check out the Carbon Quilt Initiative if you want to help out Adam and spread the word about carbon dioxide.

Jean at the Quilted Cupcake inspired the way I did the giveaway today!

Suz found a good tutorial for navigating the DNA website I had trouble with last podcast.

Thanks all!

Thanks to all the commenters on the DNA post and all the support when I was very frustrated with myself.  So far March is going much better than February.

Reeze, Allison, Colleen, Suz, Janet, Robyn, Brye, Rachel, Marceli, Sandi

h1

4.8 Podcast Preview 11 – Happy Pi Day

March 7, 2010

Thank you for the response so far to the DNA quilt.  I think if I create this quilt that is in my head, it could be amazing. 

For the next podcast, we are going to talk about Pi Day, but mainly explore two online photo editing websites out there for doing photo editing for home or quilt editing.  I am also considering doing a giveaway!

There are some other happy possibilities out there for quilt podcast listeners who would like an online community for all the quilting podcasts out there.  Stay tuned for more info on that as details start to get worked out.

h1

4.7 Podcast 10 – It is in your DNA

March 2, 2010

Podcast Feed 


A long time coming, here is the tenth episode of the Scientific Quilter podcast.  I basically had to relearn some of Biology 101 to get this information, but the end result(s) are a cool and different quilt design.  

This is the Darla version of DNA.  Because I have a very basic understanding, this will be a very basic primer for a unique end result.  

This is still very “sciency”, so for the artsy types, scroll down to the middle to bottom of the post for the DNA design. 

The Science DNA Setup 

Every living thing has in their cells the instructions, the blueprint of life.  This is the DNA or deoxyribonucleic acid found in our cell nucleus.  

We hear about DNA on Court TV shows, crime scene shows, movies, books, your auntie June.  It’s hard to escape hearing about DNA.  

 

Image from Wikipedia 

DNA is made of a series of bases in a specific order.  Cells use DNA to create amino acids which in turn create proteins, which in turn create cells, which in turn create body parts (skipping a lot of steps and details here). 

The DNA is double helix shaped, which is a “twisted ladder” shape.  Each rung of the ladder is made of a series of two bases bonded together.   

DNA has four bases called: Adenine, Thymine, Cytosine, Guanine, which we shorten to A, T, C, G.  A always binds to T, C always binds to G.  

The way that these bases sit on each rung of the ladder determine the order they will code for proteins.  

The DNA will split apart when it is time to use the DNA for coding.  Each rung of the ladder is available to bind to other bases called RNA.  

The Thymine base is not found in RNA, but Uracil (known as U) takes its place.  An Adenine base will bond with a Uracil base on the RNA, otherwise the bases will bond the same as they do on the DNA ladder rings. 

 

Image courtesy of Munich RE 

As you can see from the website diagram from Munich RE, the DNA strand gets opened up, then copied, then coded to what they call codons.  

Codons are groups of three bases.  Then each codon codes for a specific amino acid.  The amino acids are linked together to form protein chains. 

For more information about this picture visit Munich RE 

For another simple picture recap: 

 

Image courtesy of Wikipedia 

   

Making Amino Acids with DNA 

So a set of three bases codes for an amino acid.  The three bases UGG is responsible for Tryptophane, the “sleepy amino acid” that is associated with turkey and thanksgiving.  (And ‘ugg’ is how I feel when I eat too much!) 

There are 20 amino acids and a sequence that starts a protein chain and a couple of sequences that stop a protein chain.  

There are more than 20 combinations of three letters in series (believe it or not) and so several DNA sequences code for the same amino acid. 

I could provide a boring table with all the information about the amino acids (yawn), or I could show you what I found on Munich RE website! 

The image below shows a pictorial way that you can find out which amino acids are created from three bases in order. 

 

Image courtesy of Munich RE 

The image works like this.  The innermost circle is the first base of the sequence, the second ring is the second base in the sequence, and the third ring is the third base in the sequence, with the names of the amino acids vertically coming out of the diagram. 

As you can see starting with A on the diagram, then going to U, then G, you see the word START.  

When this code is found in the DNA the protein knows “hey I need to start making amino acids now”.  Then the next three bases make the next amino acid, and so on, then eventually there is found a stop amino acid and the protein know to stop coding. 

For more detailed information about this diagram and the genetic code: 

Munich RE website about the Genetic Code 

Wikipedia has several DNA-related articles about DNA the Genetic Code, and Amino Acids

Translating DNA to Quilting 

 

The DNA has been translated to quilting by a scientific quilting visionary Beverly St. Clair.  Beverly St. Clair created and started Genome Quilts.  She shows how she represents each DNA base in the quilt on her site: 

Adenine A A quilt square
Cytosine C C quilt square
Guanine G G quilt square
Thymine T T quilt square

Thus, the base sequence,  

GATCGCCCTT 

becomes 

a single row of quilt squares 

So Beverly shows the diversity of the DNA sequence in a quilt. Beverly uses a dark and light contrast to determine the bases represented in the quilt.  For her code, the different corners of dark fabric represent the different bases in the sequence.  

Since the genes that Beverly works on are 600 – 900 bases in length this could become a crazy long process to obtain the quilt. 

Completeing half square triangles like these would be an easy task that could be completed while working on other projects if you use leaders and enders.  

Leaders and Enders from Bonnie Hunter of Quiltville is a technique where you work on one project before and after other projects.  

For such a long and simple piecing process, leaders and enders would help break up the monotony of half square triangles while working on piecing for another quilt.  

I learned about this technique from one of the ladies I have been starting to sew with and it looks like it works great – even though I haven’t been doing any piecing recently to test it out.  

The genetic design comes after the triangles are pieced and so one would only pay attention to light and dark sides when piecing, and how many pieces of each color.

On LabMom’s site, she highlighted the Genome Quilt and did an excellent job in explaining the quilting site. 

   

How do you find your DNA? 

Human DNA is very similar to each other.  We are over 99% conserved which means that a DNA sequence for one human will be very, very similar to the DNA sequence for another human.  

Since we have completed the human genome, there are public websites that hold the code for an entire human on the site.

There are complicated websites such as GenBank from NCBI (given to me by an old classmate of mine) and Ensembl (given to me by LabMom).   

With luck I was able to find part of a mouse gene on the GenBank site.  But I could not tell you how or where I accomplished this.  

A second attempt to find another gene had me running in circles.  I finally found another gene for Oryza sativa Japonica Group, but the I went so many places to get there I STILL don’t know what actually took me there.  

With LabMom’s help, I was able to find a DNA sequence (because she pointed me right to it) on the Ensembl site. This is for the Estrogen Receptor.  If it doesn’t show up in the link, click sequence on the left side.  

Only the letters in red are actually coded.  The rest is just “filler DNA”.  DNA that just takes up space. 

If you’re willing to pay National Geographic and be a part of a larger project, you can order a kit (runs about 100 dollars) and you just send off a cheek swab.  They’ll analyze your DNA (mitochondrial for the ladies and y chromosome for the gentlemen).  

Beverly St Clair says that the folks at National Geographic will provide you with a sequence and show how your sequence differs from the reference sequence and this is how Beverly obtains her DNA samples currently. 

 

If you want to go with other organisms besides humans and mice, here is a quilt from the hepatitis C gene that Beverly St Clair did.  You can see that with Beverly’s process color is part of the design.  

Beverly said that the Hepititus C quilt was for a nephew who was sequencing the Hepatitis C gene, so that is where she obtained the DNA sequence for that. 

This whole thing is so Madame Defarge.  Which is what makes it interesting to me. 

   

What’s next in Quilting (what did I do with it) 

Here’s where I was thinking about the next step.  What else could you do with a quilt?  I completely respect and appreciate the work and time done already by Beverly St Clair.  

But the Scientific Quilter likes to think about what else could be done. 

There was a very good article in the American Quilter magazine March 2010 issue. 

This magazine has an article that highlights Beverly St Clair, Marjorie Taylor who quilts brain scans, Karylee Doubiago who quilts with x-rays, and Maris Azevedo who quilted her CT scan of lung tissue.   

There is not any more description in this magazine about the DNA quilt than these medical quilts.   It also didn’t say more than Beverly’s own website. 

Being fairly squeamish, other than the DNA quilt, which is more academic and theoretical than the others, I will probably stick with the DNA idea over the other medically based quilts.  

If I went that one step further, from just DNA to Codons to Amino Acids, how would I do it? 

First I started with this other website that LabMom found that organizes your thoughts – a concept map bubble website called bubbl 

This was a direct response to the Munich RE image I saw earlier.  Even though there is a lot of customization on bubbl, I got started on my amino acid bubble and decided its best left to just use the Munich RE site image above. 

I couldn’t let that image sit all crooked and uneven like that.  I’m a quilter, for goodness sake.

Also this quilt idea would not code anything, but would provide the code for what I wanted to do next. 

However the bubbl website would be good for a flow chart of a genetic trait! (another quilty idea).  Fusible web or applique would be the way to go with bias bars traveling from one idea from another.  

In bubbl, you can chose to sign in and save your designs or just export them as is. 

The DNA Quilt Design

Then I was thinking about the codon/amino acid idea.  You could designate colors for each DNA or RNA base. 

 

And then you could create boxes (my original idea was flying geese, but this idea seems to have better continuity to it).  The boxes are broken up into three sections, one for each DNA base of the codon. 

 

Here is the completed design.  There are several key things about this design. 

  • There are lighter sections and darker sections.  The lighter sections represent a protien that is coded for.  
  • The first lighter block starts with AUG at the top and the last lighter block ends with UGA.  Starts with the start codon and ends with one of the stop codons. 
  • The darker sections are the filler design.  There is no start codon until the lighter section of the quilt. 
  • You could sash with dark or light fabrics.  
  • Each box actually has 6 sections, which would be good quilt as you go sections. 
  • The top three sections are the RNA side – the amino acid side which is actually the end result. 
  • The top of the box codes with Uracil not Thymine. 
  • The bottom half of each box is the DNA side, the original code which produced the RNA side.  
  • The bottom of the box codes with Thymine, not Uracil. 

 

Just how did I arrive at the final quilt? 

Warning:  I now believe that the following process does not have the correct translation (or maybe it’s transcription step).  So I left out a step here.  But I did get to a coded result anyway. 

If you’re taking my process as correct for any science project or homework assignment, just be warned that a) it’s not nice to plagarise, and b) you might not have the correct result. (end of Warning)

Before I arrived at the diagram I had to do a little science and reasoning. 

This is the original code I started with to create this quilt: 

TACCAAGCCCTGCGGAGCAAGGTACCTCACACTTCATGAGCGAGTTAAGATGGGTTTCAC 

AATTTTTCAAGCAAGGAAACGGGCTCGGAGGTCTTGAACACCTGCTACCCAATAGCAGAA 

But T bonds with A, C bonds with G, and U replaces T in the final product.  So for the RNA these letters need to be switched around.  I’ll replace T with A and C with G, G with C, and A with U. 

I found it helps to first replace these to a different letter such as X or Y when doing replace all in microsoft word.  

AUGGUUCGGGACGCCUCGUUCCAUGGAGUGUGAAGUACUCGCUCAAUUCUACCCAAAGUG 

UUAAAAAGUUCGUUCCUUUGCCCGAGCCUCCAGAACUUGUGGACGAUGGGUUAUCGUCUU 

Now breaking it up so I can see the codons better: 

  

AUG  GUU  CGG  GAC  GCC  UCG  UUC  CAU  GGA  GUG  UGA  AGU  ACU  CGC  UCA  AUU  CUA  CCC  AAA  GUG  

UUA  AAA  AGU  UCG  UUC  CUU  UGC  CCG  AGC  CUC  CAG  AAC  UUG  UGG  ACG  AUG  GGU  UAU  CGU  CUU 

   

I see two start codons and an end codon. The code in between is “filler DNA”.  There is more to the sequence but this is all I’m doing today folks. 

   

AUG  GUU  CGG  GAC  GCC  UCG  UUC  CAU  GGA  GUG  UGA  AGU  ACU  CGC  UCA  AUU  CUA  CCC  AAA  GUG UUA  AAA  AGU  UCG  UUC  CUU  UGC  CCG  AGC  CUC  CAG  AAC  UUG  UGG  ACG  AUG  GGU  UAU  CGU  CUU 

  

Reading the graph from Munich RE shows me exactly which amino acids are coded for.  You could quilt this information in each box. 

  

START – Valine – Argine – Aspartate – Alanine – Serine – Phenylalanine – Histidine – Glycine – Valine – STOP 

   

   

Here are a couple of in-progress pictures of me while I was creating the quilt design above: 

   

 

 

So what if I made a mistake?  Then as LabDad said to LabMom in her post, it’s like you introduced a mutation.  Genius! 

What gene exactly did I post?  First two lines of the gene from site: http://uswest.ensembl.org/Homo_sapiens/Gene/Sequence?g=ENSG00000139618 (clicked sequence on the side) 

Which I think is the Estrogen Recptor that LabMom sent me in an e-mail.  Thanks for your help LabMom. 

 

Where is the Gel Electrophoresis Quilt idea? 

Warning #2: This section may contain some errors due to a mix-up of understanding on protein gel electrophoresis and DNA gel electrophoresis. 

I never took BioChem and I am thinking it shows by my confusion here.  If you would like to explain the difference to me, please feel free to send me a (nice) e-mail. End of Warning.

Gel Electrophoresis is a technique where you take proteins, cut them up into sections, make them charged (usually negatively), and then electrify them in this gel.  

The electric charge pulls the large nonpolar molecules slowly across the gel, and pulls the small polar charged molecules quickly across the gel.  

Usually in the crime scene analysis Gel electrophoresis is a way to compare with a reference sample.  Say there is some crime scene DNA and you have suspect DNA and you run them both parallel in the gel electrophoresis plates at the same time.  

Then you stain the gel to see it and hold it under blacklight.  If the suspect DNA is broken up in similar patterns to the crime scene DNA then there is a higher chance that the suspect was at the crime scene. 

 

Image courtesy of Wikipedia 

Or you can see the types of proteins in a sample this way.  This would be a good quilt design as well. 

I have already designed a quilt that looks very similar to this – the Spectra Quilt idea.  

 

Since I don’t have any proteins to analyze, I would refer back to the website that shows your blog website as DNA for inspiration on this. 

If I would quilt any gel electrophoresis style of quilt, I would quilt this as my quilt.  Again I would use bias bars for the lines. 

 

 The idea of gel electrophoresis is very similar to color chromatography.  The idea of moving some particles faster than others, spreading particles out so you can see the differences. 

I found a nice website that shows how to make your own gel electrophoresis box and separate colors the same way as color chromotography. 

The New York Times posted this article, and I think you could translate this DNA research into quilting too, but I’m not attempting it.

Other fun sites 

Code Organ This synthesizes your website into music based on what you write about. 

Bubbl A great organizational tool for concept mapping

Customized Graph Paper A great tool for drawing your own quilt designs.

Check out my Quiltversary post, and my adding audio to podcast post.

Thanks go out to my commenters and correspondents

Lynn, LynnAnne, Jill, Michele, Irene, Colleen, Toni, LabMom, Allyson, Kelley, Ruthann, Brye, Beverly St Clair, and Robyn, Jennifer, Reeze, Valerie, Ingrid, Sarah

And thanks to Munich RE and Beverly St Clair for letting me use their images on my site.

Follow

Get every new post delivered to your Inbox.

Join 63 other followers