Posts Tagged ‘design’

h1

35.6 Golden Card Trick Quilt

June 22, 2014

In my “year of FMQ” I have sat down and finally quilted this card trick quilt that I have had in the works since April of 2009. Making it my oldest UFO.

I do realize that there still needs to be one small line I missed on the card trick block itself and the corners aren’t tacked down – said I would get to them later & forgot that I never finished them until after I put my FMQ foot away for the day.

card trick showing the quilting full

The card trick & square in square blocks are quilted on the top with a golden/orange contrasting thread.

card trick straight quilting in orange brown thread

But the threads on the straight lines in the ditch around the blocks are much lighter – a light taupe for some of the straight lines.  For the swirly details I decided to pick a color in between the lighter taupe and the golden/orange, and use a golden yellow color thread for quilting.

card trick quilting ring around diamond in square fmq

Quilting is swirls and long feathers in a box around this section.

And circles and a pinched block for the middle of the blocks.

card trick quilting in between the tricks quilting

This quilting went rather well, and is the largest thing I have pushed through my Janome Magnolia machine. Not too hard to do, but too much bigger would be harder than this.

A small amount of success for finishing the quilting. I have been weary of “overquilting” this quilt, but I think this one plays nicely with some curves and some straight line free motion quilting. I have basic straight lines in the borders.

straight line border quilting

I could alternate with fills, but currently they are left plain, which is fine with me at this time.

h1

20.2 Evolution of Exothermic Wonders

October 2, 2011

Ugg.  I love / hate the design process.

Here’s a short version of a story I’d like to tell more elongatedly.

I made a weaving, rectangular, quilt design in February that matches current decor perfectly.

“Eh it’s boring”. That quilt is still in pieces, ready to be put into rows, ready for me to decide a clever weaving border for it.

… Then there’s been my recent smaller square quilts that I’ve been doing …  in addition to the hurricane quilt that hasn’t been touched since I’ve been trying to baste it to remove the oil stain on it (might not remove it all the way, it’s starting to add more character to the hurricane story I’m building around this quilt).

and more … “eh, squares are really just not my thing”, “I’m not digging that color”, “can’t you put in some more exciting blocks” ….

hmm …. okaaayyyy ….

So I was working on the alternate blocks on electric quilt for my latest quilt, Exothermic Wonders, current version that you’ve seen below.

This is what I started with. the variation I liked the most of what people also liked the most.

But I ran out of black & so did the store.  So I got some lower contrast, darker orange /red-orange fabrics for alternate blocks, and I finally put the fabrics into EQ7 this weekend, thinking as long as the blocks are fairly low contrast, there is still the main design.

Here’s one version:

But here’s the version I liked even better that that one:

I was working out how much fabric would I need for the alternate blocks as I was designing them, so I removed the outer borders from the electric quilt design, which, I have had completed for at least a month or two.

And finally, from over my shoulder:

“Hey, I like that!”  “I could see that quilt if you take out the pink ones because they’re too distracting, but I like that.”

And this was said without the borders, so I quick put the picture above on the screen and say, you mean this one?

“No.  I don’t like the borders.”  “Do it without the borders.” “Well, it’s your quilt, and you can do it how you want, but I like it without the borders – too distracting.” “This new design is simple – more symmetrical.” “The borders look too much like the quilt on the inside, same style”.

So if I listen to this request, I get a quilt that is ACTUALLY wanted, but then … not large enough.

So I need to make more of the middle blocks (that are done & have been sewn together since July, & cut since April), and then, what the heck do I do with all the borders that are also already done? I suppose I could do the back with them, or have a bonus quilt from it?

That, and to do the alternate blocks the way they are, I require more fabric anyway.  But I DO like the stability of the alternate blocks as they are.  (Actually slightly lower contrast than what’s shown here also)

So here’s my new design, assuming I don’t revert back to the border one.

Which I do admit, I like (right now).  But this means a lot of paper piecing for the alternate blocks.  Hopefully I’ll like the end result.

Tried putting the borders as alternate blocks, and I almost liked it too, less work, but more scrappy, and I do like how non-scrappy these alternate blocks are.

(sorry about the poor quality, it looks better before I post the design, don’t know what’s going on with that).

h1

14.6 Using Quilting Software for tiles

March 30, 2011

I finally subscribed to the Electric Quilt blog in my feed reader.

By the Way:  I used to use Google Reader for my main feed reader, which is adequate, but when I changed over to firefox from internet explorer, about a month ago, I found a firefox plug-in feed reader called feedly, which is quite nice for reading blogs that don’t seem so linear.

Anyway, the Electric Quilt blog had this article about someone using Electric Quilt software to design a tile pattern for their restroom.

Using Electric Quilt for Tile Design

Anyway, the quilter helped her husband with the tile design, including using the sashing for the grout, downloading a picture from the big box home improvement store to import into the fabric choice.

Here is a picture of her project below.

Very nice and very creative.  I’ve always said that quilt patterns can be found in restroom tiles.  Apparently vice-versa.

Now don’t think me perverted, we were standing outside a restroom IN THE HALLWAY at a truck stop, waiting in line for the women’s restroom and this was the view from the hallway.

I think the tile would be a fun border for a quilt, don’t you?

h1

13.7 Small Victories over EQ7 How to Draw and Color and Save a block Image

March 11, 2011

For like FOREVER, I’ve been saying that I’ll figure out EQ7, and have been taking it personally that I haven’t really spent the time to learn the program properly.

Well, today I did a small victory over “the EQ7 confusion lords,” which have subsequently cast a magic potion and convinced me that EQ7 is hard.

Victory over the same “confusion lords” who have removed any knowledge of the program from my memory, including a wonderful class taught by a friend.

I was trying to visualize a block color option for a swap, and I created the following block.

They say that teaching someone else is the best teacher, so lemme share my small victory with you. Let the lessons begin!

1) Block Menu / New Block / Easy Draw Block

2) For a nine patch, put three for the horizontal and vertical grids.  For a 16 patch, put 4 for the horizontal and vertical grids.

3) For a split 9 patch, draw the diagonal lines using the pencil tool on the left.

4) Don’t forget to draw all the rest of the lines or you’ve only created a Half Square Triangle! 😉

5) Chose the color tab on the bottom to color the block.  Then chose a color you want to use in the box that opens up.

6) Click in the middle of all the blocks you want to be a certain color.

7) Now save to sketchbook once the block is colored the way you want.

8) Color the block differently, and add to sketchbook after each set coloration you chose.  When complete, view sketchbook.

9) You’ll see the latest color option present.  Double click on the color option you want.

10) Make sure the color tab is clicked, and if you want to save this version of the image, go to file/export image.

It saves images of the block as a bitmap.

If you have other colors that have saved to the sketchbook.

11) View Sketchbook.

12) Use the arrows on the bottom left to flip through color options.  Once you have located the block color you want to save, double click the block to open it up.

13) Click the color tab on the bottom

14) File export image

For a split 9 patch, I created 6 different colored block choices and exported these images.

Due to the JPG way I saved these, there is a little bit of compression issues here, but I think you get the idea.  You can save with higher quality of jpg from the EQ7 program directly than what I used here.

TIP: Blocks do seem to look better in this format as gif or bmp, (or perhaps TIF or PNG, but I don’t use those formats)

So I hope you enjoy my small victory!

Now to set these blocks into some quilts!

h1

13.3 One More Sewing Day

March 6, 2011

I finally get to sew with some swap ladies, I think the last time we sewed together (including me) was July.

I am really looking forward to this day and I spent a lot of time in the kitchen making my pasta salad recipe (which we are starting to just love around here).

I have my quilt swap blocks for the Quiltcast Strip Twist block swap ready to go.  Just waiting on an address clarification and for the post office to be open tomorrow.

Once they are received I will post pictures of what almost went wrong, and of my block that wasn’t correct.

For now, enjoy the picture I took from my new water bottle found in the garden section of walmart.

I also got some jewel corsage pins that aren’t photographing all that well.

h1

4.7 Podcast 10 – It is in your DNA

March 2, 2010

Podcast Feed 

A long time coming, here is the tenth episode of the Scientific Quilter podcast.  I basically had to relearn some of Biology 101 to get this information, but the end result(s) are a cool and different quilt design.  

This is the Darla version of DNA.  Because I have a very basic understanding, this will be a very basic primer for a unique end result.  

This is still very “sciency”, so for the artsy types, scroll down to the middle to bottom of the post for the DNA design. 

The Science DNA Setup 

Every living thing has in their cells the instructions, the blueprint of life.  This is the DNA or deoxyribonucleic acid found in our cell nucleus.  

We hear about DNA on Court TV shows, crime scene shows, movies, books, your auntie June.  It’s hard to escape hearing about DNA.  

 

Image from Wikipedia 

DNA is made of a series of bases in a specific order.  Cells use DNA to create amino acids which in turn create proteins, which in turn create cells, which in turn create body parts (skipping a lot of steps and details here). 

The DNA is double helix shaped, which is a “twisted ladder” shape.  Each rung of the ladder is made of a series of two bases bonded together.   

DNA has four bases called: Adenine, Thymine, Cytosine, Guanine, which we shorten to A, T, C, G.  A always binds to T, C always binds to G.  

The way that these bases sit on each rung of the ladder determine the order they will code for proteins.  

The DNA will split apart when it is time to use the DNA for coding.  Each rung of the ladder is available to bind to other bases called RNA.  

The Thymine base is not found in RNA, but Uracil (known as U) takes its place.  An Adenine base will bond with a Uracil base on the RNA, otherwise the bases will bond the same as they do on the DNA ladder rings. 

 

Image courtesy of Munich RE 

As you can see from the website diagram from Munich RE, the DNA strand gets opened up, then copied, then coded to what they call codons.  

Codons are groups of three bases.  Then each codon codes for a specific amino acid.  The amino acids are linked together to form protein chains. 

For more information about this picture visit Munich RE 

For another simple picture recap: 

 

Image courtesy of Wikipedia 

   

Making Amino Acids with DNA 

So a set of three bases codes for an amino acid.  The three bases UGG is responsible for Tryptophane, the “sleepy amino acid” that is associated with turkey and thanksgiving.  (And ‘ugg’ is how I feel when I eat too much!) 

There are 20 amino acids and a sequence that starts a protein chain and a couple of sequences that stop a protein chain.  

There are more than 20 combinations of three letters in series (believe it or not) and so several DNA sequences code for the same amino acid. 

I could provide a boring table with all the information about the amino acids (yawn), or I could show you what I found on Munich RE website! 

The image below shows a pictorial way that you can find out which amino acids are created from three bases in order. 

 

Image courtesy of Munich RE 

The image works like this.  The innermost circle is the first base of the sequence, the second ring is the second base in the sequence, and the third ring is the third base in the sequence, with the names of the amino acids vertically coming out of the diagram. 

As you can see starting with A on the diagram, then going to U, then G, you see the word START.  

When this code is found in the DNA the protein knows “hey I need to start making amino acids now”.  Then the next three bases make the next amino acid, and so on, then eventually there is found a stop amino acid and the protein know to stop coding. 

For more detailed information about this diagram and the genetic code: 

Munich RE website about the Genetic Code 

Wikipedia has several DNA-related articles about DNA the Genetic Code, and Amino Acids

Translating DNA to Quilting 

 

The DNA has been translated to quilting by a scientific quilting visionary Beverly St. Clair.  Beverly St. Clair created and started Genome Quilts.  She shows how she represents each DNA base in the quilt on her site: 

Adenine A A quilt square
Cytosine C C quilt square
Guanine G G quilt square
Thymine T T quilt square

Thus, the base sequence,  

GATCGCCCTT 

becomes 

a single row of quilt squares 

So Beverly shows the diversity of the DNA sequence in a quilt. Beverly uses a dark and light contrast to determine the bases represented in the quilt.  For her code, the different corners of dark fabric represent the different bases in the sequence.  

Since the genes that Beverly works on are 600 – 900 bases in length this could become a crazy long process to obtain the quilt. 

Completeing half square triangles like these would be an easy task that could be completed while working on other projects if you use leaders and enders.  

Leaders and Enders from Bonnie Hunter of Quiltville is a technique where you work on one project before and after other projects.  

For such a long and simple piecing process, leaders and enders would help break up the monotony of half square triangles while working on piecing for another quilt.  

I learned about this technique from one of the ladies I have been starting to sew with and it looks like it works great – even though I haven’t been doing any piecing recently to test it out.  

The genetic design comes after the triangles are pieced and so one would only pay attention to light and dark sides when piecing, and how many pieces of each color.

On LabMom’s site, she highlighted the Genome Quilt and did an excellent job in explaining the quilting site. 

   

How do you find your DNA? 

Human DNA is very similar to each other.  We are over 99% conserved which means that a DNA sequence for one human will be very, very similar to the DNA sequence for another human.  

Since we have completed the human genome, there are public websites that hold the code for an entire human on the site.

There are complicated websites such as GenBank from NCBI (given to me by an old classmate of mine) and Ensembl (given to me by LabMom).   

With luck I was able to find part of a mouse gene on the GenBank site.  But I could not tell you how or where I accomplished this.  

A second attempt to find another gene had me running in circles.  I finally found another gene for Oryza sativa Japonica Group, but the I went so many places to get there I STILL don’t know what actually took me there.  

With LabMom’s help, I was able to find a DNA sequence (because she pointed me right to it) on the Ensembl site. This is for the Estrogen Receptor.  If it doesn’t show up in the link, click sequence on the left side.  

Only the letters in red are actually coded.  The rest is just “filler DNA”.  DNA that just takes up space. 

If you’re willing to pay National Geographic and be a part of a larger project, you can order a kit (runs about 100 dollars) and you just send off a cheek swab.  They’ll analyze your DNA (mitochondrial for the ladies and y chromosome for the gentlemen).  

Beverly St Clair says that the folks at National Geographic will provide you with a sequence and show how your sequence differs from the reference sequence and this is how Beverly obtains her DNA samples currently. 

 

If you want to go with other organisms besides humans and mice, here is a quilt from the hepatitis C gene that Beverly St Clair did.  You can see that with Beverly’s process color is part of the design.  

Beverly said that the Hepititus C quilt was for a nephew who was sequencing the Hepatitis C gene, so that is where she obtained the DNA sequence for that. 

This whole thing is so Madame Defarge.  Which is what makes it interesting to me. 

   

What’s next in Quilting (what did I do with it) 

Here’s where I was thinking about the next step.  What else could you do with a quilt?  I completely respect and appreciate the work and time done already by Beverly St Clair.  

But the Scientific Quilter likes to think about what else could be done. 

There was a very good article in the American Quilter magazine March 2010 issue. 

This magazine has an article that highlights Beverly St Clair, Marjorie Taylor who quilts brain scans, Karylee Doubiago who quilts with x-rays, and Maris Azevedo who quilted her CT scan of lung tissue.   

There is not any more description in this magazine about the DNA quilt than these medical quilts.   It also didn’t say more than Beverly’s own website. 

Being fairly squeamish, other than the DNA quilt, which is more academic and theoretical than the others, I will probably stick with the DNA idea over the other medically based quilts.  

If I went that one step further, from just DNA to Codons to Amino Acids, how would I do it? 

First I started with this other website that LabMom found that organizes your thoughts – a concept map bubble website called bubbl 

This was a direct response to the Munich RE image I saw earlier.  Even though there is a lot of customization on bubbl, I got started on my amino acid bubble and decided its best left to just use the Munich RE site image above. 

I couldn’t let that image sit all crooked and uneven like that.  I’m a quilter, for goodness sake.

Also this quilt idea would not code anything, but would provide the code for what I wanted to do next. 

However the bubbl website would be good for a flow chart of a genetic trait! (another quilty idea).  Fusible web or applique would be the way to go with bias bars traveling from one idea from another.  

In bubbl, you can chose to sign in and save your designs or just export them as is. 

The DNA Quilt Design

Then I was thinking about the codon/amino acid idea.  You could designate colors for each DNA or RNA base. 

 

And then you could create boxes (my original idea was flying geese, but this idea seems to have better continuity to it).  The boxes are broken up into three sections, one for each DNA base of the codon. 

 

Here is the completed design.  There are several key things about this design. 

  • There are lighter sections and darker sections.  The lighter sections represent a protien that is coded for.  
  • The first lighter block starts with AUG at the top and the last lighter block ends with UGA.  Starts with the start codon and ends with one of the stop codons. 
  • The darker sections are the filler design.  There is no start codon until the lighter section of the quilt. 
  • You could sash with dark or light fabrics.  
  • Each box actually has 6 sections, which would be good quilt as you go sections. 
  • The top three sections are the RNA side – the amino acid side which is actually the end result. 
  • The top of the box codes with Uracil not Thymine. 
  • The bottom half of each box is the DNA side, the original code which produced the RNA side.  
  • The bottom of the box codes with Thymine, not Uracil. 

 

Just how did I arrive at the final quilt? 

Warning:  I now believe that the following process does not have the correct translation (or maybe it’s transcription step).  So I left out a step here.  But I did get to a coded result anyway. 

If you’re taking my process as correct for any science project or homework assignment, just be warned that a) it’s not nice to plagarise, and b) you might not have the correct result. (end of Warning)

Before I arrived at the diagram I had to do a little science and reasoning. 

This is the original code I started with to create this quilt: 

TACCAAGCCCTGCGGAGCAAGGTACCTCACACTTCATGAGCGAGTTAAGATGGGTTTCAC 

AATTTTTCAAGCAAGGAAACGGGCTCGGAGGTCTTGAACACCTGCTACCCAATAGCAGAA 

But T bonds with A, C bonds with G, and U replaces T in the final product.  So for the RNA these letters need to be switched around.  I’ll replace T with A and C with G, G with C, and A with U. 

I found it helps to first replace these to a different letter such as X or Y when doing replace all in microsoft word.  

AUGGUUCGGGACGCCUCGUUCCAUGGAGUGUGAAGUACUCGCUCAAUUCUACCCAAAGUG 

UUAAAAAGUUCGUUCCUUUGCCCGAGCCUCCAGAACUUGUGGACGAUGGGUUAUCGUCUU 

Now breaking it up so I can see the codons better: 

  

AUG  GUU  CGG  GAC  GCC  UCG  UUC  CAU  GGA  GUG  UGA  AGU  ACU  CGC  UCA  AUU  CUA  CCC  AAA  GUG  

UUA  AAA  AGU  UCG  UUC  CUU  UGC  CCG  AGC  CUC  CAG  AAC  UUG  UGG  ACG  AUG  GGU  UAU  CGU  CUU 

   

I see two start codons and an end codon. The code in between is “filler DNA”.  There is more to the sequence but this is all I’m doing today folks. 

   

AUG  GUU  CGG  GAC  GCC  UCG  UUC  CAU  GGA  GUG  UGA  AGU  ACU  CGC  UCA  AUU  CUA  CCC  AAA  GUG UUA  AAA  AGU  UCG  UUC  CUU  UGC  CCG  AGC  CUC  CAG  AAC  UUG  UGG  ACG  AUG  GGU  UAU  CGU  CUU 

  

Reading the graph from Munich RE shows me exactly which amino acids are coded for.  You could quilt this information in each box. 

  

START – Valine – Argine – Aspartate – Alanine – Serine – Phenylalanine – Histidine – Glycine – Valine – STOP 

   

   

Here are a couple of in-progress pictures of me while I was creating the quilt design above: 

   

 

 

So what if I made a mistake?  Then as LabDad said to LabMom in her post, it’s like you introduced a mutation.  Genius! 

What gene exactly did I post?  First two lines of the gene from site: http://uswest.ensembl.org/Homo_sapiens/Gene/Sequence?g=ENSG00000139618 (clicked sequence on the side) 

Which I think is the Estrogen Recptor that LabMom sent me in an e-mail.  Thanks for your help LabMom. 

 

Where is the Gel Electrophoresis Quilt idea? 

Warning #2: This section may contain some errors due to a mix-up of understanding on protein gel electrophoresis and DNA gel electrophoresis. 

I never took BioChem and I am thinking it shows by my confusion here.  If you would like to explain the difference to me, please feel free to send me a (nice) e-mail. End of Warning.

Gel Electrophoresis is a technique where you take proteins, cut them up into sections, make them charged (usually negatively), and then electrify them in this gel.  

The electric charge pulls the large nonpolar molecules slowly across the gel, and pulls the small polar charged molecules quickly across the gel.  

Usually in the crime scene analysis Gel electrophoresis is a way to compare with a reference sample.  Say there is some crime scene DNA and you have suspect DNA and you run them both parallel in the gel electrophoresis plates at the same time.  

Then you stain the gel to see it and hold it under blacklight.  If the suspect DNA is broken up in similar patterns to the crime scene DNA then there is a higher chance that the suspect was at the crime scene. 

 

Image courtesy of Wikipedia 

Or you can see the types of proteins in a sample this way.  This would be a good quilt design as well. 

I have already designed a quilt that looks very similar to this – the Spectra Quilt idea.  

 

Since I don’t have any proteins to analyze, I would refer back to the website that shows your blog website as DNA for inspiration on this. 

If I would quilt any gel electrophoresis style of quilt, I would quilt this as my quilt.  Again I would use bias bars for the lines. 

 

 The idea of gel electrophoresis is very similar to color chromatography.  The idea of moving some particles faster than others, spreading particles out so you can see the differences. 

I found a nice website that shows how to make your own gel electrophoresis box and separate colors the same way as color chromotography. 

The New York Times posted this article, and I think you could translate this DNA research into quilting too, but I’m not attempting it.

Other fun sites 

Code Organ This synthesizes your website into music based on what you write about. 

Bubbl A great organizational tool for concept mapping

Customized Graph Paper A great tool for drawing your own quilt designs.

Check out my Quiltversary post, and my adding audio to podcast post.

Thanks go out to my commenters and correspondents

Lynn, LynnAnne, Jill, Michele, Irene, Colleen, Toni, LabMom, Allyson, Kelley, Ruthann, Brye, Beverly St Clair, and Robyn, Jennifer, Reeze, Valerie, Ingrid, Sarah

And thanks to Munich RE and Beverly St Clair for letting me use their images on my site.

h1

2.2 SQ Podcast Episode 4 – Quilting the Spectrum

December 6, 2009

Podcast Feed

Many days in science class I stared at the emission spectra posters on the wall.  Which may explain why I am drawn to the black, white and rainbow colored pattern I bought from a local quilt artist, Linda Everhart at Quilting Among Friends and the quilt on the wall at the local quilt show this past summer.

It was no surprise that when I saw the Science Craftster Swap from March that I immediately stopped to look at the spectra scarf made by echo_brook to give to pocketwatch.  Sending a message to Echo_brook, she plans to knit a blanket of the same design. Here is pocketwatch’s scarf found on page 10 (not 15) on her cool art couch.

And here is pocketwatch showing off the purple portion of the knitted scarf.  Why is the design that way with “random” purple and black (and other colors)?  It’s not random, it’s an emission spectra of Argon.  Perfect for the length of a scarf!

The emission spectra is something explored in physics and astronomy.

A tool that breaks up light is a prism, and a tool that has many “microprisms” on a thin sheet is a diffraction grating.  Prisms and diffraction gratings break up light by bending the light that travels at different speeds.  You may see “rainbow glasses” at your favorite science museum or science gift shop – that’s probably a diffraction grating that you’re buying.  Below is a picture of the diffraction grating.

A CD also can serve as a ‘makeshift’ diffraction grating.

For a summer I did research on the hydrogen spectra at Kansas State Physics Education Research Group.  It was the first time I saw a video camera with a diffraction grating taped to the side of it.  We set up our hydrogen gas tube, turned off the lights and took some pictures.  Of spectra.

What is spectra?  Spectra is a visible amount of energy due to moving electrons in an atom.  We put energy into the hydrogen atom by adding electricity, and then the electron moves away from home for a while.  Then the electron gets bored and comes back, but it doesn’t get to keep that fancy energy.  So it emits energy, some of which, is in the form of light – visible light.  And if we have the right tools to break up the light, we can get a specific pattern of colors, which we call a spectra.  Each element has a unique emission spectra due to the number of electrons and where they are located in the atom … and a bunch of other reasons.

If you want to see a periodic table that shows each specific element’s emission spectra in gif form, click here to go to the Penn State Erie site (click on each element to get to the spectra picture).   A periodic table with the symbols and element names is necessary to get the correct element here (unless you were forced to memorize the first 4 rows like I was – even several years after teaching I could remember most of them).  Feel free to search for “emission spectra” or “emission spectrum” in google for more info.

This one is Argon.  I downloaded it from the website to use for my quilt design.

Scientists will use a device called a spectroscope (dark box with a long thin slit and a “ruler” inside to measure the distance of the colors) to determine the elements that make up various gases.  For a tutorial on how to make a CD spectroscope, and a spectroscope with a cereal box and a diffraction grating, click here.

In the meantime …

Placing the diffraction grating in front of my camera lens produces interesting effects.

Using a diffraction grating on my ceiling light fixture shows bulbs of color, which demonstrates that the light source is where the rainbow is coming from.

And this following picture was of a set of 6 LEDs in a row which I liked.

Braving the December evenings I stepped outside to take a picture of the street light with the diffraction grating in front.

Turning to the side slightly about 20 – 30 degrees, you can see the spectra through the diffraction grating.  Notice the lonely cyan light, in addition to the bright green and yellow lights.

The diffraction grating had only about 1000 lines / mm.  More lines would give a higher resolution, but are also (slightly) more expensive.  Also the diffraction grating was a little dirty and I tried to clean it as best as I could.  Sodium has a distinct “double yellow” line(s) that would be easier to see with a more precise diffraction grating.  I am still betting this street lamp is sodium rather than mercury due to the brightness of the yellow here.

How can this relate to quilting?

What about a special scientific quilting design that is pleasing to the eye but also has a “hidden scientific code” inside?

I call this “coin quilt” design “Noble Metallic Spectra” (Chlorine isn’t noble gas, nor metallic, but I like the name anyway).  The symbol names in red at the bottom could be stitched as embroidery or quilting on the quilt itself.

As mentioned in the podcast you could do this as a coin quilt and consolidate the blacks (and maybe some of the colored bars) together, or you could do bias bars as the colored strips appliqued on top.

Letting my imagination run away from me, I produced a ring quilt using the polar coordinate filter on Photoshop.

This one I call “Medals of Elements” because its Copper, Silver, and Gold and traditionally medals are given as copper, silver, and gold (and they were my favorite crayon colors growing up).

Maybe I should draw up a “pattern” for these and become a scientific pattern designer?  Well first I have to create the quilts to know if they will actually work.

Additional resources

Bleach dyes websites from Deb

Websites to check out of other quilting podcasts mentioned in the show

Thanks also to my commenters

  • Janetsnina, IamSusie, Deb, Kelley, Ruthann, Lauretta6, Janet

Feel free to let me know about your scientific adventures in quilting or other crafts!

Keep experimenting!

EDIT:  I created an item with an embroidered spectra – a Sewing Machine Cover.  Find the link here!