Posts Tagged ‘Science’

h1

31.8 I come back to this quilt periodically

August 1, 2013

After a year of off and on only stitching the border around my Periodic Spiral quilt, I finally joined the ends the other day.

A couple of years ago, I started off on a journey of tiny hexagons, sewn around batik scraps collected by some of my guild members.

I was inspired by an online “maybe it’s abandoned program” which no one from the program contacted me weather it was okay or not okay to talk about their website in a blog/podcast.

I mean the Periodic Sprial quilt from the diagram on the “Periodic Spiral website“.

I have podcasted about it, blogged about it when deciding my trims, and then mentioned it again when showing some of the embroidery I did for it.

I printed out the PDF from the website onto some Printed Treasures paper.

periodic spiral website on fabric

And then I cut out the group names that I had previously embroidered.

rough layout of periodic quilt trim start

The previous photo was taken about a year ago.

Last weekend, I arranged the periodic table group name labels close to the groups in question.

trim complete periodic spiral embroidery layout

I am planning to outline each of these with trim of some sort (hasn’t been decided yet which trim). And then I am going to embroider a line from the name to the group area.

I remember making one mistake design element two years ago when setting up these hexies into blocks. I never separated non metals & metalloids, the traditional ‘staircase line’ that follows most versions of the periodic table.

So I will have to embroider it in place.

And have I shown you about the shiny fabric???

I had really prepared for this quilt last year, as the letters I made were cut out with fusible on black batik already.  And then the shiny fabric was cut to make a perfect ‘border’ around the black fabric letters.

periodic spiral with letters layout

So this year, I decided to transfer the previously cut and made letters onto the previously cut shiny fabric, after adding fusible webbing to the back of the shiny fabric strip for stability.

I referenced the Tip Sheet for Metallic & Sheer fabrics for a rough idea on how to handle this. Although I currently don’t have it sewn down yet, I think this will be a nice idea.

Really there so far, doesn’t seem to be much to it. A fusible webbing heat set onto the back of the fabric, one of those two sided ones that you have to peel off later.  And then I have my applique pressing sheet to make sure it happens okay. I don’t use the pressing sheet often, but good for me for having it & using it.

Now it is going on my wall, or rather on the front door to my sewing room, and I know I’ve been tempted by the lure of shiny fabrics in my past, but I’m not making the same mistake with this one. I made a pillow out of similar fabrics while in high school, yes it was shiny and cool feeling, but you woke up with face sparklies and for a few days didn’t know why.

The shiny fabric above leers on the edge of “gaudy” or “tacky” but as a silver background, it pops out nice with the forground colors AND evokes all the METALS that can be found as natural elements.

And so what’s probably next for this quilt is to get back out my box of trims (there are more than this) and decide what’s going around all the group names.

box of trims

I still like the black braid outlined in white that I thought about using for the whole center outline, but I have to figure out where to use it that it will go, but not attract too much attention away from the hexagon ‘star’ middle of the quilt.

For now I am contemplating that braid around the key, and maybe a black with silver beads around the group names, and maybe the same black around the words “Periodic Spiral”

h1

21.6 SQ Episode 034 – Christmas in 2011 Podcasts I Listen To

December 25, 2011

Podcast Feed

Posting & recording this on Christmas Day.  Things have been … interesting in the last week to say the least.  Sorta rambly, let’s just go with it.

Podcasts I listen to that are not quilting related. Including links below, but I personally do not use links of sites to listen to. Best bet, highlight & paste into your favorite podcast catcher the following titles.

General Radio converted into Podcasts

Semi Professional General

Science Based

Educational & Fun

How to Podcast Podcasts

Crafty Podcasts (non quilting)

Books & Lit

Are there more to add that are FANTASTIC podcasts? What do you listen to & why?

See you tomorrow for Boxing Day Sew In BDSI #BDSI

See you on Twitter. Just put in hashtag BDSI. Use TweetChat to help you sort it out. I will.

Additional Music

A Podcast Christmas Theme (edited by me) by Tom Shad

Carol of the Bells by Doug Astrop

h1

15.8 SQ Episode 026 – Periodic Table Spiral Quilt

June 5, 2011

Podcast Feed

Ever since I saw the image from Periodic Spiral, I’ve been in love with making this periodic table quilt.

Here’s a PDF of the image of the Periodic Spiral, and here is the link to the Periodic Spiral website.

I can see this exact image as an art quilt posted on a white or black background.  Lots of scrappy choices.

Or each arm could have different colors representing the similarities of each type of elements.

At the beginning of the podcast, I discussed the change of the atomic radius (size of the atom) as shown as trends in the periodic table.  Here’s a visual to what I was trying to discuss.

If you want to see a dot diagram of atomic radius as discussed in the beginning of the podcast, click here.

Further clicks on this link will show more interesting periodic table views of atomic properties.

At the end of the program, I referenced Inkscape, a vector program that can draw lines and curves beautifully.

Here is the image I copied, and the image I created.  Close enough to worry?

Quilting design lila from Sweet Dreams Quilt Studio

Oh:  Follow me on facebook Scientific Quilter, or Twitter @scientificquilt

h1

11.2 Fixed it! And more …

January 29, 2011

Whoo hoo.  All I needed was one person to agree that the letters on my “make it sew” cover would be hard to see, to convince me that I should go ahead and make the change to my current project.

Thank you Jane!

And then I … do-de-do-doo-du … fixed the problem without getting too stressed.

Here’s how. (in progress picture to follow)

As I was considering Jane’s idea of making the white letters bigger and putting them behind, I quick whipped up a photoshop touch up of the design.

Placing the larger (paper) letters in back of the smaller letters, I could see I would have problems with the W and E lining up all the way. 

So I decided to take my backwards printout, make a copy, and draw an eighth of an inch around in block form. 

Instead of cutting or anything dramatic, I just cut and fused the white right over the letters I made initially.  The original letters were already fused down, and they weren’t coming up.

I also didn’t consider (too long) remaking the star background piece, considering what I was putting over top was exactly the same size, maybe a little bit larger, even.

And then I remade the black letters, it took me some time, but not a TON.

And the result is so much nicer.

But I swear the comment from Linda proved she was in the room next to me while I was working on this project. 

She must have been phase shifted, or transported in and out when I was in the other room getting some tea.

But wait … there’s more …

On a roll now, I was able to sew down the black letters with black thread, sew on the insignia (also black thread), all the time listening to podcasts. 

I was a little annoyed with all the starts and stops that go along with sewing down applique with the machine, but it was still incredibly faster than hand applique, my usually preferred method.

But wait … there’s more …

How could I stop now?  Uninterrupted sewing time, batting, sides already completed, lining fabric easy choice to cut.

Cut, basted, quilted (straight line) all three sides.  Done, done, done.

And then I had to see if it would fit right, so i pinned it “how it would look when finished”, not “right sides together to continue on with the project”.

You may also be able to see the 5 pins sticking out the back of the top.  Theses are where I could feel the hand groove for the machine where I carry it.

Then I got a little excited because I forgot to take a few pictures.  Well I got one here (which isn’t exactly the fabric size I actually used):

Well, it is the same technique.  What you do, is

  1. you know where you have to make the opening,
  2. You draw the opening on the back of some fusible stabilizer.  The stabilizer is on the back of a gold fabric that will end up being the trim.  Make sure your trim piece has a little bit more fabric on the sides than this pic.
  3. And you pin the right side of the trim fabric with the right side of the object getting the slit
  4. You sew around the drawn opening on the outside one eighth to one quarter inch.
  5. You (carefully) take your scissors to the slit, cutting apart the fabric and the quilted part, making sure you kinda notch the fabric in the seam allowance.
  6. Don’t cut through the sewing line you just made.
  7. Start pulling the trim (gold) fabric through the slit you just made.
  8. You have to do some creative folding on the corners to have the fabric lay flat.
  9. Fold all your trim fabric down into the slit.  The line you sewed around the edge makes the edge where the trim meets the background.
  10. Top stitch just outside of the sewing line, making sure that the fabric on the inside is being caught by the topstitching.
  11. Go see Flossie Bottom’s Tutorialwhich makes more sense in pictures.

Which looks like this when finished and over the sewing machine.

And here’s the front:  TADA!

Sewing machine cover complete.  Can’t wait to blow the minds of all the ladies in the guild.  Or whoever gets me to sew next to them. 

February retreat!

Hope I don’t get tired of looking at it.  Only took 10 hours of work today and before today: 

I had the embroidery part done, the insignia cut out, the background done (with all the particular stripes of fabrics fussy cut) and everything that I had to redo today.

You can find my other posts on this topic here, here, here, and here.

h1

9.2 SQ Episode 019 – The Velocity of Quilting – Part 2

December 5, 2010

Podcast Feed

The velocity of quilting is how we think of quilting using velocity terms and concepts. The concepts are defined in Part 1 of this episode.

  

Direction

The direction you travel mentally and physically correspond to your quilting goals. Finding out what you want to accomplish.

Ask yourself the questions and you’ll find your quilting velocity direction:

  1. What type of project do I want to do?
  2. How much work am I willing to do towards the project? 
  3. Do I know how to start the project or are there learning steps to handle before I get to that point?
  4. How much do I still have to purchase in supplies to finish the project?
  5. Am I creating the project for someone else?
  6. What is the project intended for? Is it for a wallhanging, a treasured bed quilt, a new baby, a tired kiddo, a memory of someone long gone?

Or you could actually think about the physical directions to obtain your quilting supplies:

  1. What direction to the nearest quilt shop?
  2. How many quilt shops can I steer away from on my long trip to somewhere else?
  3. What part of the store do you like the most, the back where all the quilt samples are, the front where all the fat quarters are located?

Another direction consideration is in free motion quilting:

  1. When free motion quilting what direction do you keep your quilt?
  2. Can you move the quilt vs move the machine? 
  3. What direction do you push your quilt to stuff it into the harp/throat areas?
  4. What advantage is a quilt rack/stand that moves the machine compared to moving the quilt?
  5. What direction are your legs in, are you sitting or standing?
  6. What direction do your shoulders go if you scrunch them up all the time quilting?

Other times to consider direction of quilting (not mentioned in the podcast):

  1. What direction do you cut the fabric (lengthwise or crosswise grain)?
  2. What direction are you moving your rotary cutter when you cut the grain?
  3. What direction are your applique pieces that are stuck on the wrong side of your fabric?
  4. What direction do you press the seams?

 

Instantaneous Velocity vs Average Velocity

Image from flickr,  By Allie_Caulfield

Instantaneous Velocity

  • Instantaneous velocity and the hare
  • Stopping projects midstream to work on something else (or take a nap)
  • Working on quick projects that take minimal effort, learning time, materials
  • Being satisfied for making a project quickly
  • An instantaneous velocity of zero is still a velocity.
  • Define the amount of time you want to define as “an instant”
  • Are you okay with leaving in mistakes?
  • Set up your equipment, tools, surroundings, sewing space to help maximize sewing time and minimize downtime
  • Product based quilting – more projects = more things put on etsy = more chance to feed yourself

 

Image from flickr, by iregretjumping

Average Velocity

  • In reality, for many projects, you may be facing time frames of years or months
  • Slow and steady wins the race, just ask the tortoise
  • Slowing down gives you more time to reflect, make changes, define the best techniques for your quilt
  • The time it takes to gather the fabric, materials, learn the techniques, cut, sew, quilt & bind the quilt all adds in to the total quilting time for one project
  • Pick up a new technique and try it.  Adds to your total quilting time and lowers your velocity, but can help you in the long run.

 

Frame of Reference

Referencing others

Wait a minute, everyone is finishing projects faster than me….

  • Wow!  This is cool!  I should try to do more projects, sewing, etc.

or

  • Oh no!  I don’t know how to work that fast!  How can I ever keep up?

Pick your attitude to help suit you best.  Keep in mind all the life distractions that you don’t want to / aren’t able to miss. 

Give yourself permission to be slower/faster than others depending on your unique situation and pressures.

You also may actually have a higher velocity of projects than other people.  If so, encourage or help others to finish up!

You can also reference yourself.

  • Some people as they learn new techniques, can speed up over time because they aren’t referencing the source material as much.
  • Some people find it more valuable to slow down as they gain more knowledge to be able to produce quilts with better quality. 
  • Doing it right by spending a little more time on it may be more satisfying and save the headache of unsewing (negative project velocity)

 

Image from flickr, by garryknight 

Thanks for the comments.  We need to think of how much we want to sew, how quickly we need to sew, and what that will do to the final project. 

  • Will we burn up our machine by literally going pedal to the metal? 
  • Will we drag our feet to complete a project we don’t want to complete? 
  • Will we put less value on our projects for ourselves than on the projects for others and put the effort into finishing things for others over finishing our own stuff?
  • Will we regret sewing too fast and trying to get a project done in time?
  • Will we sew fast enough to complete a project for a fellow swapper?

I had a blast at my very first quilting retreat lately.  I have been tearing it up getting a lot of quilting projects nearer to completion!

Are you a slow poke quilter too? Sign up and show off your slow quilting velocity!

  

Velocity Giveaway

Giveaway Details for the Great Velocity Experiment

We’re going to close on January 6th, 2011 to be considered eligible for the velocity experiment giveaway. 

If you find this site after that date, please feel free to participate by going to my Quilting Velocity Experiment page anyway!

At the current time, it will be easy to be eligible as we have very few entries!

Additional Music

From freesound.org

        By SirmXe 
            Twisted Feeling – Keys 140 BPM.mp3

From Mevio’s Music Alley

A Golden Day by Axel Schneider

Inner Focus by Absent Machine

Sands of Egypt by John Gillat

The Marionette by Two Star Symphony

Novellette in D Major by Mario Ajero

h1

7.4 Home Sewing Front – Spectra Quilt

July 18, 2010

So I started playing around with EQ7 this morning.  I have successfully read through the entire user’s manual (at Jiffy Lube, during lunch breaks, falling asleep). 

I wasn’t at the computer while reading, but I at least have heard of the terms used in the program a little bit at this point.

I thought I had a good handle on how to navigate EQ7, and considering my experience in photoshop, thought that the whole thing would be a piece of cake to navigate.

Well, it’s OK, and I don’t know if it’s just my lack of experience or what, but I have been taking longer than expected to handle the navigation of the program.

You put everything you want to do in your sketchbook before you use it.  And then you have to color everything.  I haven’t even figured out how to color a block and then put it into a quilt that way – all i’ve used on colors is preset color choices and then changing them to colors I want.  But what if I chose to keep some blocks different colors (or the same) than what the presets? 

I did a drawing with freedraw (or some name I don’t remember) and used Serendipity to make it kaleidoscope, but then I couldn’t put my new kaleidoscoped block into another block. 

I suppose if I export the block I may have the control I want, but the program said that it couldn’t do what I wanted to at the time.

And I didn’t notice that the coin quilt block was there, and I was having a hard time with making my spectra quilt until I just imported each spectra as a photo. 

 

I didn’t know how to make a coin quilt from the start because that option wasn’t a preset (although I have been told there are coin quilt blocks available, I haven’t done that yet).  The way I set up my spectrum quilt to get this picture is:

  • Vertical Strip Quilt
  • 1st Block 4.5 inches
  • 2nd Block 1.5 inches
  • 3rd Block 4.5 inches
  • with a 1.5 inch border

This size may make a nice table runner, my overall size is 19.5 X 34 inches which fits the space I have wonderfully.  I didn’t have a sashing option by doing a vertical strip quilt style, and since this is based on a photograph this was overcome by making the sashing strips the size of my inner ‘blocks’.

I was hoping for some more help in figuring out exactly how wide each spectra would have to be, but I did the math and a little Dimensional Analysis (yes science, math and chemistry practice has come in handy here!) and played around with my quilt size to make the math easier and I have a lovely start on my spectra quilt – USING PHOTOSHOP. 

Sorry folks, but I had to go back to my old standby when I kept trying to zoom in farther and farther on my picture within the completed quilt and couldn’t get the thing to do what I wanted it to do.

 Having 10 years of playtime on photoshop probably made it easier to figure out how to get the program to behave better than a program I’ve had for a month and a half which I haven’t taken computer time to decipher yet.

To get the size of each bias bar accurately (which I am not doing by the way), I had to do the following photoshop steps:

  1. Set a grid up.  The grid is modified in Edit/Preferences/Guides,Grids&Slices.  I set up grids every 4 subdivisions every 4 pixels.  Using dots.
  2. Zoom in on my original picture far enough. 
  3. Pick some crazy colors 
  4. Set up the paintbrush tool to 1.0 pixel in size
  5. Each ‘dotted box’ I put a colored dot just along the side of the picture.
  6. Each 1 dot was green, every 5 dots was red.  Very tedious steps (5&6)
  7. Then I changed to a different color (blue) and every 2 red dots put a dot to the right (every 10 pixels)
  8. New color, every 20 pixels (two blue dots) put a dot (purple)
  9. New color, every 50 pixels (two and a half purple dots) put a dot (yellow).
  10. This made it easy to count the total number of pixels in each row, and gave me a fairly accurate idea of where in each row the colored lines were. 
  11. I had a total of 310 dots, so I made the length of the quilt 31 inches so that each inch would be 10 dots. 
  12. I really should go metric with the calculations from here, but no one sews a metric seam allowance.  If you feel the urge, I know that 2.54 centimeters = 1 inch, so you can do some more dimensional analysis to figure it out if you so choose.
  13. I put all these dots on a new layer in photoshop so I can move the layer around to each of the strips and ‘count’ where the lines are. 
  14. The strips are all about 1/10 or 1/5 of an inch finished, but I don’t have any bias tape makers that go that far, so I’ll have to get out my bias bars and use the thinnest one available. 
  15. I’ll approximate on the color values used for each color and perhaps vary the brightness at this point

This makes me happy that at least I am thinking about this project – AND I am using math – AND I am using dimensional analysis – something for which both chemistry and physics heavily prepared me.

But today, a sewing day, I worked more on my black and white quilt.  Black and white borders complete, sewed onto the quilt (measured heavily because of how I had to strip the setting trapeziods) and started on my ‘handdrawn celtic border corners’.  12 total.  1 down, 11 to go.

This, in no way, is a negative review of EQ7.  I haven’t discovered the possibilities yet on this. 

But it is a reflection that I need to use the things I can do with EQ7 and the things I can do with photoshop and put the talents together while I learn and play with the possibilities (and limitations) of both programs. 

I know people would like a podcast/review on EQ7, and I have to wait to know what is going on before doing so, but when I get to it, I’ll see if I can cook up something. 

It felt very nice to not only be creative today in the computer programs, but also very comfortable to be doing the math that I’ve been avoiding unnecessarily.  Incredible how odd that feels to say, but so very true.

h1

7.1 Podcast Episode 014 – Self Reflection Stereotypes

June 30, 2010

Podcast Feed

This podcast is the first of a series on identity and self reflection. 

If you have any thoughts on changing identity, how your career affects your quilting style, your self confidence level, your personality (meyer’s briggs or other) type, or other self exploratory processes, please comment below or send an e-mail or sign up for big tent and give your answers there.

This series starts with the topic of stereotypes

  • Science/nerdy/geeky stereotype
  • Quilter stereotype
  • A possible call to action
  • What is a stereotype, why do we stereotype
  • How the brain thinks with stereotypes comparing it to grouping

Scientific, nerdy, geeky stereotypes

Several pop culture characters and real life people embody the nerdy stereotype

Remember this famous character from TGIF television and all the guys to follow

What about this high school prep, skater, jock, nerd? Someone to look up to?  Someone to name your kids after?

What about a music mogul?

How about some other real life scientists that are changing the stereotype?

Scientist / food guru AB

Or a couple of “blow it up” / test it out busters of myths

If there are things in common with these people, could you call their commonalities a stereotype? 

Is there something that holds them together, and over time, have they changed the face of the nerdy world?

A shift in our acceptance caused a few geek sites

A shift in the science viewing stereotypes, showing some of the traits below

A Taxedo Word Cloud

Stereotypes for quilters

Let’s combine stereotypical superheroes and quilters in a funny mental image

Nanananana, Quilt Guild!

Can you imagine quilters fighting crime?  What makes the image so funny? (Can you draw one? I can’t draw)

Tagedo Word Cloud on Quilting

Perhaps quilting needs a popularization to become a popular culture rather than just a stereotype?

But the question would be, should we be popularizing the ideal image of a quilter, or the ‘antistereotype’? 

One method that may try to both embrace the traditional and the new would be the Modern Quilt Guild

 

Call to Action

Get out there and spread the word about quilting.  What message are you sending?

What is stereotyping?

If you list the traits that are characteristic about a group of people you create a stereotype.  Stereotype is a mental idea that organizes data about a group.

Stereotypes can be formed implicitly or automatically.

Uses of stereotypes

  • allows us to process information effectively
  • organizes many things into groups to describe multiple things quickly
  • information that fits stereotypes will be remembered quickly
  • information that goes against the stereotype may be dismissed or discarded
  • people can only process and use so much information at once – groups are needed for the brain to assimilate and process ideas – and remember them
  • people can communicate large amounts of information at once, although the received image may not be exactly the same as the intended one

Common uses of stereotypes in the quilting world

If you detach the human side of stereotyping and think more of categorizing items and objects, we see stereotypes in quilting.

Think of blog categories and tags.  When we are documenting blog posts or pictures, we group them.  This is to help us to remember them later. 

Delicious is set up so that tags are organized, and many people may put the same tags, and organize websites in the same way.

Does average equal stereotype?  Do you have a picture of a quilter in your head because of the quilting in america data?

Do we characterize quilters because of the raw numbers?  Do quilters fit the stereotype, or does the stereotype fit the quilter?

Did you have a stereotypical image of a quilter before knowing the average quilter?

American Patchwork and Allpeoplequilt.com have a video about “I am a quilter” so you can see all the differences in quilters.

Thanks to all my commenters and correspondents! 

Check out the Quiltcast Supergroup on Big Tent and join in on the discussion!

h1

4.7 Podcast 10 – It is in your DNA

March 2, 2010

Podcast Feed 

A long time coming, here is the tenth episode of the Scientific Quilter podcast.  I basically had to relearn some of Biology 101 to get this information, but the end result(s) are a cool and different quilt design.  

This is the Darla version of DNA.  Because I have a very basic understanding, this will be a very basic primer for a unique end result.  

This is still very “sciency”, so for the artsy types, scroll down to the middle to bottom of the post for the DNA design. 

The Science DNA Setup 

Every living thing has in their cells the instructions, the blueprint of life.  This is the DNA or deoxyribonucleic acid found in our cell nucleus.  

We hear about DNA on Court TV shows, crime scene shows, movies, books, your auntie June.  It’s hard to escape hearing about DNA.  

 

Image from Wikipedia 

DNA is made of a series of bases in a specific order.  Cells use DNA to create amino acids which in turn create proteins, which in turn create cells, which in turn create body parts (skipping a lot of steps and details here). 

The DNA is double helix shaped, which is a “twisted ladder” shape.  Each rung of the ladder is made of a series of two bases bonded together.   

DNA has four bases called: Adenine, Thymine, Cytosine, Guanine, which we shorten to A, T, C, G.  A always binds to T, C always binds to G.  

The way that these bases sit on each rung of the ladder determine the order they will code for proteins.  

The DNA will split apart when it is time to use the DNA for coding.  Each rung of the ladder is available to bind to other bases called RNA.  

The Thymine base is not found in RNA, but Uracil (known as U) takes its place.  An Adenine base will bond with a Uracil base on the RNA, otherwise the bases will bond the same as they do on the DNA ladder rings. 

 

Image courtesy of Munich RE 

As you can see from the website diagram from Munich RE, the DNA strand gets opened up, then copied, then coded to what they call codons.  

Codons are groups of three bases.  Then each codon codes for a specific amino acid.  The amino acids are linked together to form protein chains. 

For more information about this picture visit Munich RE 

For another simple picture recap: 

 

Image courtesy of Wikipedia 

   

Making Amino Acids with DNA 

So a set of three bases codes for an amino acid.  The three bases UGG is responsible for Tryptophane, the “sleepy amino acid” that is associated with turkey and thanksgiving.  (And ‘ugg’ is how I feel when I eat too much!) 

There are 20 amino acids and a sequence that starts a protein chain and a couple of sequences that stop a protein chain.  

There are more than 20 combinations of three letters in series (believe it or not) and so several DNA sequences code for the same amino acid. 

I could provide a boring table with all the information about the amino acids (yawn), or I could show you what I found on Munich RE website! 

The image below shows a pictorial way that you can find out which amino acids are created from three bases in order. 

 

Image courtesy of Munich RE 

The image works like this.  The innermost circle is the first base of the sequence, the second ring is the second base in the sequence, and the third ring is the third base in the sequence, with the names of the amino acids vertically coming out of the diagram. 

As you can see starting with A on the diagram, then going to U, then G, you see the word START.  

When this code is found in the DNA the protein knows “hey I need to start making amino acids now”.  Then the next three bases make the next amino acid, and so on, then eventually there is found a stop amino acid and the protein know to stop coding. 

For more detailed information about this diagram and the genetic code: 

Munich RE website about the Genetic Code 

Wikipedia has several DNA-related articles about DNA the Genetic Code, and Amino Acids

Translating DNA to Quilting 

 

The DNA has been translated to quilting by a scientific quilting visionary Beverly St. Clair.  Beverly St. Clair created and started Genome Quilts.  She shows how she represents each DNA base in the quilt on her site: 

Adenine A A quilt square
Cytosine C C quilt square
Guanine G G quilt square
Thymine T T quilt square

Thus, the base sequence,  

GATCGCCCTT 

becomes 

a single row of quilt squares 

So Beverly shows the diversity of the DNA sequence in a quilt. Beverly uses a dark and light contrast to determine the bases represented in the quilt.  For her code, the different corners of dark fabric represent the different bases in the sequence.  

Since the genes that Beverly works on are 600 – 900 bases in length this could become a crazy long process to obtain the quilt. 

Completeing half square triangles like these would be an easy task that could be completed while working on other projects if you use leaders and enders.  

Leaders and Enders from Bonnie Hunter of Quiltville is a technique where you work on one project before and after other projects.  

For such a long and simple piecing process, leaders and enders would help break up the monotony of half square triangles while working on piecing for another quilt.  

I learned about this technique from one of the ladies I have been starting to sew with and it looks like it works great – even though I haven’t been doing any piecing recently to test it out.  

The genetic design comes after the triangles are pieced and so one would only pay attention to light and dark sides when piecing, and how many pieces of each color.

On LabMom’s site, she highlighted the Genome Quilt and did an excellent job in explaining the quilting site. 

   

How do you find your DNA? 

Human DNA is very similar to each other.  We are over 99% conserved which means that a DNA sequence for one human will be very, very similar to the DNA sequence for another human.  

Since we have completed the human genome, there are public websites that hold the code for an entire human on the site.

There are complicated websites such as GenBank from NCBI (given to me by an old classmate of mine) and Ensembl (given to me by LabMom).   

With luck I was able to find part of a mouse gene on the GenBank site.  But I could not tell you how or where I accomplished this.  

A second attempt to find another gene had me running in circles.  I finally found another gene for Oryza sativa Japonica Group, but the I went so many places to get there I STILL don’t know what actually took me there.  

With LabMom’s help, I was able to find a DNA sequence (because she pointed me right to it) on the Ensembl site. This is for the Estrogen Receptor.  If it doesn’t show up in the link, click sequence on the left side.  

Only the letters in red are actually coded.  The rest is just “filler DNA”.  DNA that just takes up space. 

If you’re willing to pay National Geographic and be a part of a larger project, you can order a kit (runs about 100 dollars) and you just send off a cheek swab.  They’ll analyze your DNA (mitochondrial for the ladies and y chromosome for the gentlemen).  

Beverly St Clair says that the folks at National Geographic will provide you with a sequence and show how your sequence differs from the reference sequence and this is how Beverly obtains her DNA samples currently. 

 

If you want to go with other organisms besides humans and mice, here is a quilt from the hepatitis C gene that Beverly St Clair did.  You can see that with Beverly’s process color is part of the design.  

Beverly said that the Hepititus C quilt was for a nephew who was sequencing the Hepatitis C gene, so that is where she obtained the DNA sequence for that. 

This whole thing is so Madame Defarge.  Which is what makes it interesting to me. 

   

What’s next in Quilting (what did I do with it) 

Here’s where I was thinking about the next step.  What else could you do with a quilt?  I completely respect and appreciate the work and time done already by Beverly St Clair.  

But the Scientific Quilter likes to think about what else could be done. 

There was a very good article in the American Quilter magazine March 2010 issue. 

This magazine has an article that highlights Beverly St Clair, Marjorie Taylor who quilts brain scans, Karylee Doubiago who quilts with x-rays, and Maris Azevedo who quilted her CT scan of lung tissue.   

There is not any more description in this magazine about the DNA quilt than these medical quilts.   It also didn’t say more than Beverly’s own website. 

Being fairly squeamish, other than the DNA quilt, which is more academic and theoretical than the others, I will probably stick with the DNA idea over the other medically based quilts.  

If I went that one step further, from just DNA to Codons to Amino Acids, how would I do it? 

First I started with this other website that LabMom found that organizes your thoughts – a concept map bubble website called bubbl 

This was a direct response to the Munich RE image I saw earlier.  Even though there is a lot of customization on bubbl, I got started on my amino acid bubble and decided its best left to just use the Munich RE site image above. 

I couldn’t let that image sit all crooked and uneven like that.  I’m a quilter, for goodness sake.

Also this quilt idea would not code anything, but would provide the code for what I wanted to do next. 

However the bubbl website would be good for a flow chart of a genetic trait! (another quilty idea).  Fusible web or applique would be the way to go with bias bars traveling from one idea from another.  

In bubbl, you can chose to sign in and save your designs or just export them as is. 

The DNA Quilt Design

Then I was thinking about the codon/amino acid idea.  You could designate colors for each DNA or RNA base. 

 

And then you could create boxes (my original idea was flying geese, but this idea seems to have better continuity to it).  The boxes are broken up into three sections, one for each DNA base of the codon. 

 

Here is the completed design.  There are several key things about this design. 

  • There are lighter sections and darker sections.  The lighter sections represent a protien that is coded for.  
  • The first lighter block starts with AUG at the top and the last lighter block ends with UGA.  Starts with the start codon and ends with one of the stop codons. 
  • The darker sections are the filler design.  There is no start codon until the lighter section of the quilt. 
  • You could sash with dark or light fabrics.  
  • Each box actually has 6 sections, which would be good quilt as you go sections. 
  • The top three sections are the RNA side – the amino acid side which is actually the end result. 
  • The top of the box codes with Uracil not Thymine. 
  • The bottom half of each box is the DNA side, the original code which produced the RNA side.  
  • The bottom of the box codes with Thymine, not Uracil. 

 

Just how did I arrive at the final quilt? 

Warning:  I now believe that the following process does not have the correct translation (or maybe it’s transcription step).  So I left out a step here.  But I did get to a coded result anyway. 

If you’re taking my process as correct for any science project or homework assignment, just be warned that a) it’s not nice to plagarise, and b) you might not have the correct result. (end of Warning)

Before I arrived at the diagram I had to do a little science and reasoning. 

This is the original code I started with to create this quilt: 

TACCAAGCCCTGCGGAGCAAGGTACCTCACACTTCATGAGCGAGTTAAGATGGGTTTCAC 

AATTTTTCAAGCAAGGAAACGGGCTCGGAGGTCTTGAACACCTGCTACCCAATAGCAGAA 

But T bonds with A, C bonds with G, and U replaces T in the final product.  So for the RNA these letters need to be switched around.  I’ll replace T with A and C with G, G with C, and A with U. 

I found it helps to first replace these to a different letter such as X or Y when doing replace all in microsoft word.  

AUGGUUCGGGACGCCUCGUUCCAUGGAGUGUGAAGUACUCGCUCAAUUCUACCCAAAGUG 

UUAAAAAGUUCGUUCCUUUGCCCGAGCCUCCAGAACUUGUGGACGAUGGGUUAUCGUCUU 

Now breaking it up so I can see the codons better: 

  

AUG  GUU  CGG  GAC  GCC  UCG  UUC  CAU  GGA  GUG  UGA  AGU  ACU  CGC  UCA  AUU  CUA  CCC  AAA  GUG  

UUA  AAA  AGU  UCG  UUC  CUU  UGC  CCG  AGC  CUC  CAG  AAC  UUG  UGG  ACG  AUG  GGU  UAU  CGU  CUU 

   

I see two start codons and an end codon. The code in between is “filler DNA”.  There is more to the sequence but this is all I’m doing today folks. 

   

AUG  GUU  CGG  GAC  GCC  UCG  UUC  CAU  GGA  GUG  UGA  AGU  ACU  CGC  UCA  AUU  CUA  CCC  AAA  GUG UUA  AAA  AGU  UCG  UUC  CUU  UGC  CCG  AGC  CUC  CAG  AAC  UUG  UGG  ACG  AUG  GGU  UAU  CGU  CUU 

  

Reading the graph from Munich RE shows me exactly which amino acids are coded for.  You could quilt this information in each box. 

  

START – Valine – Argine – Aspartate – Alanine – Serine – Phenylalanine – Histidine – Glycine – Valine – STOP 

   

   

Here are a couple of in-progress pictures of me while I was creating the quilt design above: 

   

 

 

So what if I made a mistake?  Then as LabDad said to LabMom in her post, it’s like you introduced a mutation.  Genius! 

What gene exactly did I post?  First two lines of the gene from site: http://uswest.ensembl.org/Homo_sapiens/Gene/Sequence?g=ENSG00000139618 (clicked sequence on the side) 

Which I think is the Estrogen Recptor that LabMom sent me in an e-mail.  Thanks for your help LabMom. 

 

Where is the Gel Electrophoresis Quilt idea? 

Warning #2: This section may contain some errors due to a mix-up of understanding on protein gel electrophoresis and DNA gel electrophoresis. 

I never took BioChem and I am thinking it shows by my confusion here.  If you would like to explain the difference to me, please feel free to send me a (nice) e-mail. End of Warning.

Gel Electrophoresis is a technique where you take proteins, cut them up into sections, make them charged (usually negatively), and then electrify them in this gel.  

The electric charge pulls the large nonpolar molecules slowly across the gel, and pulls the small polar charged molecules quickly across the gel.  

Usually in the crime scene analysis Gel electrophoresis is a way to compare with a reference sample.  Say there is some crime scene DNA and you have suspect DNA and you run them both parallel in the gel electrophoresis plates at the same time.  

Then you stain the gel to see it and hold it under blacklight.  If the suspect DNA is broken up in similar patterns to the crime scene DNA then there is a higher chance that the suspect was at the crime scene. 

 

Image courtesy of Wikipedia 

Or you can see the types of proteins in a sample this way.  This would be a good quilt design as well. 

I have already designed a quilt that looks very similar to this – the Spectra Quilt idea.  

 

Since I don’t have any proteins to analyze, I would refer back to the website that shows your blog website as DNA for inspiration on this. 

If I would quilt any gel electrophoresis style of quilt, I would quilt this as my quilt.  Again I would use bias bars for the lines. 

 

 The idea of gel electrophoresis is very similar to color chromatography.  The idea of moving some particles faster than others, spreading particles out so you can see the differences. 

I found a nice website that shows how to make your own gel electrophoresis box and separate colors the same way as color chromotography. 

The New York Times posted this article, and I think you could translate this DNA research into quilting too, but I’m not attempting it.

Other fun sites 

Code Organ This synthesizes your website into music based on what you write about. 

Bubbl A great organizational tool for concept mapping

Customized Graph Paper A great tool for drawing your own quilt designs.

Check out my Quiltversary post, and my adding audio to podcast post.

Thanks go out to my commenters and correspondents

Lynn, LynnAnne, Jill, Michele, Irene, Colleen, Toni, LabMom, Allyson, Kelley, Ruthann, Brye, Beverly St Clair, and Robyn, Jennifer, Reeze, Valerie, Ingrid, Sarah

And thanks to Munich RE and Beverly St Clair for letting me use their images on my site.

h1

4.1 SQ Podcast 9 – Keep Experimenting Everyone!

February 5, 2010

Podcast Feed

Cookie-Cutter Experiments vs Design your own

Already designed items are appealing due to overcoming obstacles in time, money, experience, fear, energy, motivation, or static friction.  Some examples of pre-designed experiments are:

  • cross stitch & embroidery patterns
  • knitting & crochet patterns
  • quilting kits
  • BOM’s
  • free motion stencils

The other choice is to design it yourself.  There is much fun in coming up with

  • quilt block patterns (see Tuxedo Designs blog)
  • quilt pattern placement or size (on point, baby sized, with sashing …)
  • hand drafting quilting patterns (see Leah Day Free motion quilting designs blog)
  • color choices
  • fabric types
  • thread choices
  • color values
  • rick rack choices
  • applique patterns

(see my Machine experiment number 1 post for more details of my personal design experiment inspired by Leah Day’s blog)

(also see Tuxedo Park Designs’ personal blog where he takes common blocks and experiments with color and placement and scale – good insight into the experimental design process)

As much fun as it is designing your own stuff, it is also fun to decide what materials and tools to use for your project.  For me, sometimes that takes the form of scientific experimentation. (or just experimenting – or just playing)

(A small number of) Ideas for quilt-related experiments in this fashion:

  • brand of quilting gloves
  • type of needle (sharps vs milners vs betweens ..)
  • thimbles (like in Quilter’s Home mag)
  • Machine quilting surfaces
  • types of material to quilt with (cotton, flannel, knits ….)
  • thread brands

Experimental Design

Going through an example, we can discuss the finer points of setting up good quilty experiments

Get your question figured out and focused

  • Lets say I want to know about thread – specifically thread durability while machine quilting

Come up with a hypothesis something I want to know

  • I think that different brands of thread affect quilt durability during machine quilted applications (this should probably be more specific still)

Figure out how do you measure if your hypothesis is true (finding out your manipulated variables)

  • Amount of time, stress, and washing affect quilt durability.
  • Any one of these three measurements can be used as their own separate experiment – remember to focus

How do you show that changes in your variables will result in changes to your quilts?

  • Mini Experiment 1:  Hang weights on a quilt that is machine quilted for 30 days.  Take observations daily of the quilt and compare results from day 1 to day 30 – extend this longer if necessary
  • Mini Experiment 2:  Hanging a quilt with a sleeve using different amounts of weight (different stresses on the quilts).  Take observations of how much weight is on the quilt when the quilt thread breaks or stretches. 
  • Mini Experiment 3:  Washing a quilt for 30 washes (decide if you want to use detergent or if you want to machine dry your quilt or you want to wash with rocks in your washing machine to help enhance the wear on it).  Take observations of your quilt after each wash (or 5) and compare results from no washes to 30 washes – extend to more washes if necessary

Notice that in:

  • Experiment 1 we are changing the number of days.  Days or time is our manipulated variable in this experiment.
  • Experiment 2 we are changing the stress on the quilt. (using weights)
  • Experiment 3 we are changing the amount of washing time.

All these experiments may tell you about the ‘durability’ of the thread types. 

You may find after this point that you want to only focus on one part of the experiment or you may want to be more specific still on your hypothesis. 

  • Maybe you only want to test the amount of wear on the quilt due to washing, and then decide to use different types of washing settings (hot water/cold water), detergents, dryer settings, amount of stress and other clothes in the washer at the same time …

Playing with Variables

DON’T make ALL the changes to your quilt simultaneously if you want to find out the real cause of your manipulated variable.

  • If you change the stress, washing, and days, you could have results, but what were the results actually from??

Keep everything else the same.   You don’t want to change anything that may throw off your results

  • Use the same fabrics/batting machine/ stitch length for each type of thread you’re testing …

This is the controlling variable idea of your experiment.  You can have a “control” with which to measure everything against. 

  • Your control in each of the experiments we have set up is the completed quilt on the first day with no weights or washes.  Find a way to make good observations of your control (take pictures, notes, feel for puckers) before you start. 

Always start with a ZERO result.  Sometimes you can make 2 duplicate copies and leave one alone and test the other to help with comparisons. 

  • Like they do on the washing detergent commercials, only have one quilt with zero washes and the other quilt with 20 washes or 30 washes

Set up a rubric so you can tell “what is better”.  This can be done mentally or you can give it a point value

  • Best score for the washing quilt experiment is that after repeated washes there are no frays, puckers, raveled edges.  Or you can do a pull test on the two fabrics and just pull them apart and see if they will pull apart easily.

Be prepared to make changes.  Successful experiments can, and should, be changed and restarted with different techniques once you have some experience under your belt.

  • Increase your amount of time, figure out a clever way to add stress without using weights. 
  • Then go back to the start and retake your data

Tips

Go small scale to figure out if you’re even in the ball park.  Mythbusters does this well.

Be prepared for a hypothesis to be disproven.   Try to get your data in an objective way without putting your “wishes into it”. 

For example maybe my friend sells these really awesome quilting gloves, and I wanted to prove they were better than other brands of gloves.  And it turns out that the friend’s brand stinks. 

As long as you don’t tell your friend that they stink – try to keep the emotion away from the testing.  Put your emotion into something more useful.  Like designing that award-winning quilt!

Some fun websites related to web 2.0

Searching Marion’s blog I found her useful sites and I would like to also borrow one of her useful sites off of this post:

Why didn’t I mention this in the podcast?  This is another Great site!

Make Blog led me to Indestructables DIY site for step by step tutorials

More fun

Just look at my wonderful acorn PRIZE from Mirkwood Designs for doing a podcast-inspired project!  So soft and look at the detail and quality of the card as well!

Her podcast number 4 details the soft block carving.  Here look at my stamp project

 

Here is my signature block with some (useless) walmart tools and the (useful) exacto knife.  Cost: $1 for eraser, $4 for walmart tools (not necessary), and $5 (I think) exacto knife – has lots of blade types

I drew with pencil onto paper, then rubbed the pencil eraser onto the soft block eraser

Carving the image is not hard at all, but you have to be VERY careful – sharps – and VERY patient.  Did this while watching ‘radio TV’.

The completed stamp and bits.

Additional Resources about the topic:

Thanks to my commenters:

Check out the posts from LabMom on

Space inspired quilt idea sites from Peggi

I am seeing a little bit of traffic from specific sites that put me on their blogroll.  Specifically the Triangle Modern Quilt Guild   Thanks!

Thanks guys and Keep experimenting!

h1

3.9 SQ Podcast Episode 8 – What’s that word?

January 22, 2010

 Podcast Feed     

Although slightly unusual for a science/math/quilting blog and podcast, I want to focus on vocabulary.      

Screen Capture from http://www.wordle.net

Occurences with complex vocabulary in technical disciplines    

What is it about all this scientific and mathematical vocabulary, notation, jargon, acronyms?  Is it there to make us smarter and understand more or is it there just to confuse us?  The following are some scientific examples of extreme vocabulary (look at your own risk)    

In math you have all the integral signs and the large sigma and the n-notation everywhere.      

In physics, essentially you learn the greek alphabet, math, equations everywhere!      

Chemistry is no better, with all the organic chemistry notation.  For example one diastereomer is trans-3-methylcyclopentanol (I have no idea what that is used for, but it looks complicated, right?)  The other enantiomer is cis-3-methlycyclopentanol in case you’re wondering.    

Biology for me was hard due to endless lists of vocabulary.  Just opening one page in my book gives me: squamous cells, cuboidal cells, simple epithelium, stratified epi…… (okay I’ll stop here!)    

With terms like this, its easy to stop in your tracks and run the other way.  Sure.  Go ahead.  See ya next podcast and post if you follow suit. But for a vocabulary adventure, keep reading.     

      

Eschew Obfuscation in the English Language and what to do about vocabulary intimidation     

But you don’t encounter intimidating vocabulary only in the science classroom.  Or in any classroom.  There are things all around us that cause us to feel intimidated just by saying them out loud.     

The English language being one of the great intimidators.   The existence of the word irregardless.  Spelling bee words.  A new (to me) phrase brought to my attention by one of my commenters:  Eschew Obfuscation    

After doing a little bit of research, I found out that “eschew obfuscation” means “avoid confusion“.    

Sometimes intimidating vocabulary can be used (like I did with the science words) to intimidate you.  Or as Timelady says: “sometimes (people) genuinely do not realise that it is unreasonable to expect others to understand such words – perhaps they are (using) technical jargon, abbreviations, acronyms”. 

Do I feel that a lot of people in my life do this on a regular basis? – NO.     

Do I feel that quilters have such a crazy complicated vocabulary such that they cannot express their meaning to me in a way I can’t understand? – Also NO.    

If someone does intimidate you verbally, Timelady says to counter with something to the effect of: “oh I don’t know what that word means.  Could you tell me?  Thanks for increasing my language skills”.     

To avoid confusion when writing, an Eschew Obfuscation website suggests to   

  • write simply
  • write concisely
  • assume the reader is naive
  • use the active voice
  • present tense
  • positive language
  • common language
  • avoid acronyms
  • organize thoughts sequentially and logically

(a few of these I have to work on myself.)    

       

Possible confusing vocabulary in our hobbies    

With hobbies of any kind, science fiction, fishing, quilting … etc. there is usually a learning curve to understanding the hobby.    

  • Learning product and equipment names can seem confusing to use.  Materials used in creating a project have their own names, brands, and acronyms. 
  • Other times it is a specific technique that is being demonstrated, and a skill that has to be learned. 
  • Sometimes abstract concepts are best described with a certain word or phrase like “color value”, gradation, contrast.  Some of these techniques are simple in idea, but also complicated such that it takes a lifetime to master.
  • Space saving when communicating is facilitating our use of acronyms and symbols.  Text messaging, tweeting, and constant communication is shortening our words and ideas to “WIPS” “UFO’s” “HSY” (haven’t started yet – heard by me first on Annie Smith’s Quilting Stash). 
  • Referring to loved ones as DH, DD, MIL, …. is necessary sometimes to protect privacy. 

The reason I haven’t pursued crochet and knitting is the pattern and symbol notations used in patterns as space savers.  I see the pattern notation, don’t take time to analyze it, and put the project down, never to start on it.  I COULD figure it out if I had the desire to learn, but for now I’ll just do quilting with its visual blocks.     

  

The above picture is a Screen capture from http://www.wordle.net  

   

Strategies for overcoming intimidating vocabularies  

Once past the apathy, here are specific strategies for increasing vocabulary (in quilting or other):  

  • Dictionaries, lots of dictionaries. Ruthann has dictionaries everywhere. Christine has dictionaries at work and at home. I use www.m-w.com or www.dictionary.com or www.wikipedia.com to learn about things I don’t understand.
  • iPhones (with access to dictionary.com) and Kindles have places to look up vocabulary too, so you don’t have to carry around a large dictionary everywhere you go.
  • Listen to Podcasts, listening to complicated words spoken several times gets you familiar to the words and ideas.  This makes it easier when you actually do the technique or use the product.
  • Watch Videos – Same as podcasts – gives you exposure, ideas, lets you see and hear together what is meant by various techniques and words
  • Write the word down several times – in context
  • Make up your own story or your own sentence 
  • Ask someone who brings it up to explain, then give them an example sentence or situation and see if you understand (my personal favorite a lot of times)
  • Learn the root words, prefixes and suffixes.  That organic chemistry compound earlier can be explained in its parts. For non-chemistry examples: hetero- means different, chrom- means color, epi- means above -graph means write …
  • Use word clouds to gain familiarity. Create your own on Wordle or Tagul.
  • Google search – or your favorite web search engine.
  • Post on a forum about what other people know. People are generally helpful enough to answer your questions.
  • Use mnemonics to help your brain link common terms and objects to more complicated ones

   

  

Screen capture from http://www.tagul.com    

   

Do teacher-type techniques for extreme vocabulary learning (like for tests when you HAVE to know words)   

  • Make it fun. Create word crosses, word searches, and puzzles at discovery puzzlemaker site
  • Matching quiz. Write or copy the list of words and the list of definitions and paste each into two separate columns in a word processing or spreadsheet program.  Then alphabetize all the words alphabetically, and alphabetize all the definitions reverse alphabetically.  Do a matching game.
  • Create flashcards.  Used this to demonstrate the idea of stoichiometry in equations.  Physically moving something around helped with movement and learning.  As quilters, we move around the parts of our quilt blocks – that is similar to how to learn balancing equations.
  • Create a blog about a new word or idea.  Chances are that teaching someone else something will help you learn it better yourself.  Blogs are good for this.

    

 Something fun    

I hope you enjoy a little crossword that I created using words from Quilt University’s own Quilt Glossary.  You can find the PDF below.    

Go to Wordle and Tagul for your own word designs (having trouble with embedding links on my blog somehow)    

How about a Dictionary.com 

 Some Vocabulary podcasts I found (listened a lot to Grammar Girl – very good podcast!)    

Here’s my First Completed Quilt!    

This quilt was done from Carol Doak’s Your First Quilt Book, ribbons pattern.  Most color and quilting decisions made by Carol Doak.     

    

The completed quilt above and a bit of quilting close up below,    

    

and if you didn’t see it last week, a close up of the binding    

     

I need to read more carefully Jennifer Ruvalcaba’s episode notes next time for the binding, or not worry about the sleeve so much.    

Additional Resources    

Quilting Dictionary Sites   

 Brawndo website from the movie Idiocracy (not endorsing the product, but look at all the marketing!)  
What do you think about dihydrogen monoxide (DHMO)? 

Thanks    

Special thanks to my encourager commenters: Jill (e-mail), Jill (post on blog), Colleen, Debby, Ingrid, Reeze    

Thanks also to my other new commenters and e-mailers: Sister Diane, Ann, TimeLady, LabMom, driftwood, Kathy, Dru, Tuxedo Designs, Leah Day, Michele Foster, Lana, Ruthann, Christine, Peggi, Christine, Marion    

Specifically check out    

the Scientific Inspiration post from LabMom    

the fibonacci quilt tutorial from driftwood    

the Scientific Quilter Origin story on Quilting Gallery